The role of protecting groups in the formation of organogels through a nano-fibrillar network formed by self-assembling terminally protected tripeptides

A series of eight synthetic self-assembling terminally blocked tripeptides have been studied for gelation. Some of them form gels in various aromatic solvents including benzene, toluene, xylene, and chlorobenzene. It has been found that the protecting groups play an important role in the formation of organogels. It has been observed that, if the C-terminal has been changed from methyl ester to ethyl ester the gelation property does not change significantly (keeping the N-terminal protecting group same), while the change of the protecting group from ethyl ester to isopropyl ester completely abolishes the gelation property. Similarly, keeping the identical C-terminal protecting group (methyl ester) the results of the gelation study indicate that the substitution of N-terminal protection Boc-(tert-butyloxycarbonyl) to Cbz-(benzyloxycarbonyl) does change the gelation property insignificantly, while the change from Boc- to pivaloyl (Piv-) or acetyl (Ac-) group completely eliminates the gelation property. Morphological studies of the dried gels of two of the peptides indicate the presence of an entangled nano-fibrillar network that might be responsible for gelation. FTIR studies of the gels demonstrate that an intermolecular hydrogen bonding network is formed during gelation. Results of X-ray powder diffraction studies for these gelator peptides in different states (dried gels, gel, and bulk solids) reflected that the structure in the wet gel is distinctly different from the dried gel and solid state structures. Single crystal X-ray diffraction studies of a non-gelator peptide, which is structurally similar to the gelator molecules reveal that the peptide forms an antiparallel beta-sheet structure in crystals. (c) 2007 Elsevier Ltd. All rights reserved.

A catemer-to-dimer structural transformation in cyheptamide

A catemeric crystal structure of cyheptamide undergoes a transformation in the solid-state upon heating to produce a dimer-based form whose structure has been determined from laboratory X-ray powder diffraction ( XRPD) data, thereby providing the first conclusive evidence of a carbamazepine analogue crystallising in both hydrogen bonded motifs.

Structure and stability of two polymorphs of creatine and its monohydrate

An experimental search for crystalline forms of creatine including a variable temperature X-ray powder diffraction study has produced three polymorphs and a formic acid solvate. The crystal structures of creatine forms I and II were determined from X-ray powder diffraction data plus the creatine formic acid (1 : 1) solvate structure was obtained by single crystal X-ray diffraction methods. Evidence of a third polymorphic form of creatine obtained by rapid desolvation of creatine monohydrate is also presented. The results highlight the role of automated parallel crystallisation, slurry experiments and VT-XRPD as powerful techniques for effective physical form screening. They also highlight the importance of various complementary analytical techniques in structural characterisation and in achieving better understanding of the relationship between various solid-state forms. The structural relationships between various solid-state forms of creatine using the XPac method provided a rationale for the different relative stabilities of forms I and II of creatine with respect to the monohydrate form.

Accurate molecular structures of chlorothiazide and hydrochlorothiazide by joint refinement against powder neutron and X-ray diffraction data

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

A powder neutron diffraction study of the metallic ferromagnet Co3Sn2S2

Variable-temperature powder neutron diffraction data reveal that Co3Sn2S2 crystallizes in the shandite structure (space group R (3) over barm, a = 5.36855(3)angstrom, c = 13.1903(1) angstrom at 300 K). The structural relationship between Co3Sn2S2 and the intermetallic compound CoSn, both of which contain Kagome nets of cobalt atoms, is discussed. Resistivity and Seebeck coefficient measurements for Co3Sn2S2 are consistent with metallic behaviour. Magnetic susceptibility measurements indicate that Co3Sn2S2 orders ferromagnetically at 180(10) K, with a saturation moment of 0.29 mu(B) per cobalt atom at 5 K. The onset of magnetic ordering is accompanied by marked anomalies in the electrical transport properties. (c) 2008 Elsevier Masson SAS. All rights reserve

Crystal and molecular structure of the thioether-analogue of PEEK from X-ray powder data and diffraction-modelling

Analysis of X-ray powder data for the melt-crystallisable aromatic poly(thioether thioether ketone) [-S-Ar-S-Ar-CO-Ar](n), ('PTTK', Ar= 1,4-phenylene), reveals that it adopts a crystal structure very different from that established for its ether-analogue PEEK. Molecular modelling and diffraction-simulation studies of PTTK show that the structure of this polymer is analogous to that of melt-crystallised poly(thioetherketone) [-SAr-CO-Ar](n) in which the carbonyl linkages in symmetry-related chains are aligned anti-parallel to one another. and that these bridging units are crystallographically interchangeable. The final model for the crystal structure of PTTK is thus disordered, in the monoclinic space group 121a (two chains per unit cell), with cell dimensions a = 7.83, b = 6.06, c = 10.35 angstrom, beta = 93.47 degrees. (c) 2005 Elsevier Ltd. All rights reserved.

First structural analysis of a naphthalene-based poly(ether ketone): Crystal and molecular simulation from X-ray powder data and diffraction modeling

Polycondensation of 2,6-dihydroxynaphthalene with 4,4'-bis(4"-fluorobenzoyl)biphenyl affords a novel, semicrystalline poly(ether ketone) with a melting point of 406 degreesC and glass transition temperature (onset) of 168 degreesC. Molecular modeling and diffraction-simulation studies of this polymer, coupled with data from the single-crystal structure of an oligomer model, have enabled the crystal and molecular structure of the polymer to be determined from X-ray powder data. This structure-the first for any naphthalene-containing poly(ether ketone)-is fully ordered, in monoclinic space group P2(1)/b, with two chains per unit cell. Rietveld refinement against the experimental powder data gave a final agreement factor (R-wp) of 6.7%.

Modeling the structure of amorphous MoS3: a neutron diffraction and reverse Monte Carlo study

A model for the structure of amorphous molybdenum trisulfide, a-MoS3, has been created using reverse Monte Carlo methods. This model, which consists of chains Of MoS6 units sharing three sulfurs with each of its two neighbors and forming alternate long, nonbonded, and short, bonded, Mo-Mo separations, is a good fit to the neutron diffraction data and is chemically and physically realistic. The paper identifies the limitations of previous models based on Mo-3 triangular clusters in accounting for the available experimental data.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

A synchrotron powder X-ray diffraction study of the skutterudite-related phases AB1.5Te1.5 (A=Co, Rh, Ir; B= Ge, Sn)

X-ray resonant scattering has been exploited to investigate the crystal structure of the AB1.5Te1.5 phases (A = Co, Rh, Ir; B = Ge, Sn). Analysis of the diffraction data reveals that CoGe1.5Te1.5 and ASn1.5Te1.5 adopt a rhombohedral skutterudite-related structure, containing diamond-shape B2Te2 rings, in which the B and Te atoms are ordered and trans to each other. Anion ordering is however incomplete, and with increasing the size of both cations and anions, the degree of anion ordering decreases. By contrast, the diffraction data of IrGe1.5Te1.5 are consistent with an almost statistical distribution of the anions over the available sites, although some ordered domains may be present. The thermoelectric properties of these materials are discussed in the light of these results.