38 resultados para empirical studies in ubiquitous and mobile computing


Relevância:

100.00% 100.00%

Publicador:

Resumo:

During red wine aging, there is a loss of anthocyanins and the formation of various other pigments, so-called vitisins A, which are formed through the chemical interaction of the original anthocyanins with pyruvic acid. The objective of this study was to investigate the antioxidant activities of the most abundant anthocyanins present in red wine (glycosides of delphinidin, petunidin, and malvidin) and their corresponding vitisins A. Anthocyanins exhibited a higher iron reducing as well as 2,2'-azinobis (3-ethyl-benzothiazoline-6-sulfonate) and peroxyl radical scavenging activity than their corresponding vitisins A. Delphinidin showed the highest antioxidant effect of the tested compounds in all of the assays used. Furthermore, we studied the effect of anthocyanins and vitisins A on platelet aggregation and monocyte and endothelial function. Anthocyanins and vitisins did not affect nitric oxide production and tumor necrosis factor-alpha (TNF-alpha) secretion in lipopolysaccharide plus interferon-gamma-activated macrophages. Furthermore, anthocyanins and vitisins did not change collagen-induced platelet aggregation in vitro. However, anthocyanins and to a lesser extent vitisins exhibited protective effects against TNF-alpha-induced monocyte chemoattractant protein production in primary human endothelial cells.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The phase separation behaviour in aqueous mixtures of poly(methyl vinyl ether) and hydroxypropylcellulose has been studied by cloud points method and viscometric measurements. The miscibility of these blends in solid state has been assessed by infrared spectroscopy; methanol vapours sorption experiments and scanning electron microscopy. The values of Gibbs energy of mixing of the polymers and their blends with methanol as well as between each other were calculated. It was found that in solid state the polymers can interact with methanol very well but the polymer-polymer interactions are unfavourable. Although in aqueous solutions the polymers exhibit some intermolecular interactions their solid blends are not completely miscible. (C) 2005 Elsevier Ltd. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A number of Intelligent Mobile Robots have been developed at the University of Reading. They are completely autonomous in that no umbilical cord attaches to them to extra power supplies or computer station: further, they are not radio controlled. In this paper, the robots are discussed, in their various forms, and the individual behaviours and characteristics which appear are considered.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The theoretical understanding of online shopping behavior has received much attention. Less focus has been given to the formation of the customer experience (CE) that results from online shopper interactions with e-retailers. This study develops and empirically tests a model of the relationship between antecedents and outcomes of online customer experience (OCE) within Internet shopping websites using an international sample. The study identifies and provides operational measures of these variables plus the cognitive and affective components of OCE. The paper makes contributions towards new knowledge and understanding of how e-

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Ethnopharmacological relevance: Studies on traditional Chinese medicine (TCM), like those of other systems of traditional medicine (TM), are very variable in their quality, content and focus, resulting in issues around their acceptability to the global scientific community. In an attempt to address these issues, an European Union funded FP7 consortium, composed of both Chinese and European scientists and named “Good practice in traditional Chinese medicine” (GP-TCM), has devised a series of guidelines and technical notes to facilitate good practice in collecting, assessing and publishing TCM literature as well as highlighting the scope of information that should be in future publications on TMs. This paper summarises these guidelines, together with what has been learned through GP-TCM collaborations, focusing on some common problems and proposing solutions. The recommendations also provide a template for the evaluation of other types of traditional medicine such as Ayurveda, Kampo and Unani. Materials and methods: GP-TCM provided a means by which experts in different areas relating to TCM were able to collaborate in forming a literature review good practice panel which operated through e-mail exchanges, teleconferences and focused discussions at annual meetings. The panel involved coordinators and representatives of each GP-TCM work package (WP) with the latter managing the testing and refining of such guidelines within the context of their respective WPs and providing feedback. Results: A Good Practice Handbook for Scientific Publications on TCM was drafted during the three years of the consortium, showing the value of such networks. A “deliverable – central questions – labour division” model had been established to guide the literature evaluation studies of each WP. The model investigated various scoring systems and their ability to provide consistent and reliable semi-quantitative assessments of the literature, notably in respect of the botanical ingredients involved and the scientific quality of the work described. This resulted in the compilation of (i) a robust scoring system and (ii) a set of minimum standards for publishing in the herbal medicines field, based on an analysis of the main problems identified in published TCM literature.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This paper evaluates the US’ perception of and response to al-Qaeda in the Arabian Peninsula (AQAP) operating in Yemen. It evaluates the empirical evidence on which the present understanding of the group is based, the implications of the socio-political context in which it operates, and the uneasy position of the Yemeni government in the war against terror as it has been affected by US policy from the early 1990s to the present. In the contested Yemeni state, AQAP is competing for political legitimacy and is increasingly dependent on public support. The US’ kill-or-capture response, the “on-off” nature of its support that has made Yemen vulnerable to the influence of al-Qaeda in the past, and the actions of the Yemeni government itself, which depends on the continued existence of the threat to secure financial support vital for political survival, means that none of the measures being taken has the potential to defeat AQAP.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Small interfering RNA (siRNA), antisense oligonucleotides (ODNs), ribozymes and DNAzymes have emerged as sequence-specific inhibitors of gene expression that may have therapeutic potential in the treatment of a wide range of diseases. Due to their rapid degradation in vivo, the efficacy of naked gene silencing nucleic acids is relatively short lived. The entrapment of these nucleic acids within biodegradable sustained-release delivery systems may improve their stability and reduce the doses required for efficacy. In this study, we have evaluated the potential in vitro and in vivo use of biodegradable poly (d,l-lactide-co-glycolide) copolymer (PLGA) microspheres as sustained delivery devices for ODNs, ribozyme, siRNA and DNA enzymes. In addition, we investigated the release of ODN conjugates bearing 5′-end lipophilic groups. The in vitro sustained release profiles of microsphere-entrapped nucleic acids were dependent on variables such as the type of nucleic acid used, the nature of the lipophilic group, and whether the nucleic acid used was single or double stranded. For in vivo studies, whole body autoradiography was used to monitor the bio-distribution of either free tritium-labelled ODN or that entrapped within PLGA microspheres following subcutaneous administration in Balb-c mice. The majority of the radioactivity associated with free ODN was eliminated within 24 h whereas polymer-released ODN persisted in organs and at the site of administration even after seven days post-administration. Polymer microsphere released ODN exhibited a similar tissue and cellular tropism to the free ODN. Micro-autoradiography analyses of the liver and kidneys showed similar bio-distribution for polymer-released and free ODNs with the majority of radioactivity being concentrated in the proximal convoluted tubules of the kidney and in the Kupffer cells of the liver. These findings suggest that biodegradable PLGA microspheres offer a method for improving the in vivo sustained delivery of gene silencing nucleic acids, and hence are worthy of further investigation as delivery systems for these macromolecules.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The property development industry is a key actor in UK brownfield regeneration projects. UK policy has attempted to interlink ‘sustainable development’ and ‘sustainable brownfield’ policy agendas, which have found an additional focus through the UK government’s ‘Sustainable Communities Plan’, part of a growing international emphasis on sustainable development. This paper examines the emergence of these agendas and related policies, and the role of the property development industry in the regeneration of six differing brownfield sites, based in Thames Gateway and Greater Manchester. Using a conceptual framework, the paper investigates aspects of the sustainability of these projects and highlights key lessons from them for both the UK and overseas. The research is based on structured interviews with a variety of stakeholders, including developers, planners, consultants and community representatives to highlight emerging best practice and related policy implications.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Existing buildings contribute greatly to global energy use and greenhouse gas emissions. In the UK, about 18% of carbon emissions are generated by non-domestic buildings; sustainable building refurbishment can play an important role in reducing carbon emissions. This paper looks at the performance of a recently refurbished 5-storey office building in London, in terms of energy consumption as well as occupants’ satisfaction. Pre- and post-occupancy evaluation studies were conducted using online questionnaire surveys and energy consumption evaluation. Results from pre-occupancy and post-occupancy evaluation studies showed that employees, in general, were more satisfied with their work environment at the refurbished building than with that of their previous office. Employees’ self-reported productivity improved after the move to Elms House. These surveys showed a positive relationship between employees’ satisfaction with their work environment and their self-reported productivity, well-being and enjoyment at work. The factor that contributed to increasing employee satisfaction the most was: better use of interior space. Although the refurbishment was a success in terms of reducing energy consumption per m2, the performance gap was almost 3 times greater than that estimated. Unregulated loads, problems with building control, ineffective use of space and occupants’ behaviour are argued to be reasons for this gap.