The phytocannabinoid Delta(9)-tetrahydrocannabivarin modulates inhibitory neurotransmission in the cerebellum

Background and purposeThe phytocannabinoid Delta(9)-tetrahydrocannabivarin (Delta(9)-THCV) has been reported to exhibit a diverse pharmacology; here, we investigate functional effects of Delta(9)-THCV, extracted from Cannabis sativa, using electrophysiological techniques to define its mechanism of action in the CNS.Experimental approachEffects of Delta(9)-THCV and synthetic cannabinoid agents on inhibitory neurotransmission at interneurone-Purkinje cell (IN-PC) synapses were correlated with effects on spontaneous PC output using single-cell and multi-electrode array (MEA) electrophysiological recordings respectively, in mouse cerebellar brain slices in vitro.Key resultsThe cannabinoid receptor agonist WIN 55,212-2 (WIN55) decreased miniature inhibitory postsynaptic current (mIPSC) frequency at IN-PC synapses. WIN55-induced inhibition was reversed by Delta(9)-THCV, and also by the CB(1) receptor antagonist AM251; Delta(9)-THCV or AM251 acted to increase mIPSC frequency beyond basal values. When applied alone, Delta(9)-THCV, AM251 or rimonabant increased mIPSC frequency. Pre-incubation with Delta(9)-THCV blocked WIN55-induced inhibition. In MEA recordings, WIN55 increased PC spike firing rate; Delta(9)-THCV and AM251 acted in the opposite direction to decrease spike firing. The effects of Delta(9)-THCV and WIN55 were attenuated by the GABA(A) receptor antagonist bicuculline methiodide.Conclusions and implicationsWe show for the first time that Delta(9)-THCV acts as a functional CB(1) receptor antagonist in the CNS to modulate inhibitory neurotransmission at IN-PC synapses and spontaneous PC output. Delta(9)-THCV- and AM251-induced increases in mIPSC frequency beyond basal levels were consistent with basal CB(1) receptor activity. WIN55-induced increases in PC spike firing rate were consistent with synaptic disinhibition; whilst Delta(9)-THCV- and AM251-induced decreases in spike firing suggest a mechanism of PC inhibition.British Journal of Pharmacology advance online publication, 3 March 2008; doi:10.1038/bjp.2008.57.

Evolution of the modern Nile delta promontories: development of accretional features during shoreline retreat

The active accretional features that have developed along the modern Nile Delta promontories during shoreline retreat are analysed using topographic maps, remote imagery, ground and hydrographic surveys, together providing 15 time-slice maps (1922-2000) at Rosetta and 14 time-slice maps (1909-2000) at Damietta. Small double sandy spits developed and persisted at Rosetta between 1986 and 1991. At Damietta, a much larger single spit, 9 km long, formed approximately east of the mouth of the Damietta Nile branch between 1955 and 1972, although its source has now been depleted. Both the Rosetta and Damietta inlets are associated with submerged mouth bars that accumulated prior to the damming of the Nile, but that continue to contribute to local sedimentation problems, particularly at Rosetta. The development of the active accretional features along the Nile promontories reflects a combination of factors including sediment availability, transport pathways from source areas, a decrease in the magnitude of Nile flood discharges, as well as the impact of protective structures at the river mouths.

Supramolecular parallel beta-sheet and amyloid-like fibril forming peptides using delta-aminovaleric acid residue

Four terminally blocked tripeptides containing delta-aminovaleric acid residue self-assemble to form supramolecular beta-sheet structures as are revealed from their FT-IR data. Single crystal X-ray diffraction studies of two representative peptides also show that they form parallel beta-sheet structures. Self-aggregation of these beta-sheet forming peptides leads to the formation of fibrillar structures, as is evident from scanning electron microscopic (SEM) and transmission electron microscopic (TEM) images. These peptide fibrils bind to a physiological dye, Congo red and exhibit a typical green-gold birefringence under polarized light, showing close resemblance to neurodegenerative disease causing amyloid fibrils. (c) 2005 Elsevier Ltd. All rights reserved.

Supramolecular helix and beta-sheet through self-assembly of two isomeric tetrapeptides in crystals and formation of filaments and ribbons in the solid state

Single crystal X-ray diffraction studies show that the beta-turn structure of tetrapeptide I, Boc-Gly-Phe-Aib-Leu-OMe (Aib: alpha-amino isobutyric acid) self-assembles to a supramolecular helix through intermolecular hydrogen bonding along the crystallographic a axis. By contrast the beta-turn structure of an isomeric tetrapeptide II, Boc-Gly-Leu-Aib-Phe-OMe self-assembles to a supramolecular beta-sheet-like structure via a two-dimensional (a, b axis) intermolecular hydrogen bonding network and pi-pi interactions. FT-IR studies of the peptides revealed that both of them form intermolecularly hydrogen bonded supramolecular structures in the solid state. Field emission scanning electron micrographs (FE-SEM) of the dried fibrous materials of the peptides show different morphologies, non-twisted filaments in case of peptide I and non-twisted filaments and ribbon-like structures in case of peptide II.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Crystal design approaches for the synthesis of paracetamol co-crystals

Crystal engineering principles were used to design three new co-crystals of paracetamol. A variety of potential cocrystal formers were initially identified from a search of the Cambridge Structural Database for molecules with complementary hydrogen-bond forming functionalities. Subsequent screening by powder X-ray diffraction of the products of the reaction of this library of molecules with paracetamol led to the discovery of new binary crystalline phases of paracetamol with trans-1,4- diaminocyclohexane (1); trans-1,4-di(4-pyridyl)ethylene (2); and 1,2-bis(4-pyridyl)ethane (3). The co-crystals were characterized by IR spectroscopy, differential scanning calorimetry, and 1H NMR spectroscopy. Single crystal X-ray structure analysis reveals that in all three co-crystals the co-crystal formers (CCF) are hydrogen bonded to the paracetamol molecules through O−H···N interactions. In co-crystals (1) and (2) the CCFs are interleaved between the chains of paracetamol molecules, while in co-crystal (3) there is an additional N−H···N hydrogen bond between the two components. A hierarchy of hydrogen bond formation is observed in which the best donor in the system, the phenolic O−H group of paracetamol, is preferentially hydrogen bonded to the best acceptor, the basic nitrogen atom of the co-crystal former. The geometric aspects of the hydrogen bonds in co-crystals 1−3 are discussed in terms of their electrostatic and charge-transfer components.

Using laboratory and field measurements to constrain a single habit shortwave optical parameterization for cirrus

A single habit parameterization for the shortwave optical properties of cirrus is presented. The parameterization utilizes a hollow particle geometry, with stepped internal cavities as identified in laboratory and field studies. This particular habit was chosen as both experimental and theoretical results show that the particle exhibits lower asymmetry parameters when compared to solid crystals of the same aspect ratio. The aspect ratio of the particle was varied as a function of maximum dimension, D, in order to adhere to the same physical relationships assumed in the microphysical scheme in a configuration of the Met Office atmosphere-only global model, concerning particle mass, size and effective density. Single scattering properties were then computed using T-Matrix, Ray Tracing with Diffraction on Facets (RTDF) and Ray Tracing (RT) for small, medium, and large size parameters respectively. The scattering properties were integrated over 28 particle size distributions as used in the microphysical scheme. The fits were then parameterized as simple functions of Ice Water Content (IWC) for 6 shortwave bands. The parameterization was implemented into the GA6 configuration of the Met Office Unified Model along with the current operational long-wave parameterization. The GA6 configuration is used to simulate the annual twenty-year short-wave (SW) fluxes at top-of-atmosphere (TOA) and also the temperature and humidity structure of the atmosphere. The parameterization presented here is compared against the current operational model and a more recent habit mixture model.