Control and analysis of oriented thin films of lipid inverse bicontinuous cubic phases using grazing incidence small-angle X‑ray scattering

Lipid cubic phases are complex nanostructures that form naturally in a variety of biological systems, with applications including drug delivery and nanotemplating. Most X-ray scattering studies on lipid cubic phases have used unoriented polydomain samples as either bulk gels or suspensions of micrometer-sized cubosomes. We present a method of investigating cubic phases in a new form, as supported thin films that can be analyzed using grazing incidence small-angle X-ray scattering (GISAXS). We present GISAXS data on three lipid systems: phytantriol and two grades of monoolein (research and industrial). The use of thin films brings a number of advantages. First, the samples exhibit a high degree of uniaxial orientation about the substrate normal. Second, the new morphology allows precise control of the substrate mesophase geometry and lattice parameter using a controlled temperature and humidity environment, and we demonstrate the controllable formation of oriented diamond and gyroid inverse bicontinuous cubic along with lamellar phases. Finally, the thin film morphology allows the induction of reversible phase transitions between these mesophase structures by changes in humidity on subminute time scales, and we present timeresolved GISAXS data monitoring these transformations.

A novel X-ray rheometer for in situ studies of polymer melts and solutions during shear flow

A novel X-ray rheometer based on a parallel plate geometry is described. This system allows time-resolved X-ray scattering intensity data to be obtained from polymeric samples subjected to shear flow. The range of quantitative structural parameters, such as molecular orientation and inter chain correlations, which can be obtained from the data is highlighted. Examples of the utility of X-ray scattering in examining optically opaque samples and the extraction of 〈P2〉 and 〈P4〉 orientation parameters are given using anisotropic hydroxypropylcellulose solutions as the sample.

A wide-angle X-ray study of the development of molecular orientation in crosslinked natural rubber

Molecular orientation parameters have been measured for the non-crystalline component of crosslinked natural rubber samples deformed in uniaxial tension as a function of the extension ratio and of temperature. The orientation parapeters 〈P2(cosα)〉 and 〈P4(cosα)〉 were obtained by an analysis of the anisotropy of the wide-angle X-ray scattering functions. For the measurements made at high temperatures the level of crystallinity detected was negligible and the orientation-strain behaviour could be compared directly with the predictions of molecular models of rubber elasticity. The molecular orientation behaviour with strain was found to be at variance with the estimates of the affine model particularly at low and moderate strains. Extension of the crosslinked rubber at room temperature led to strain-crystallization and measurements of both the molecular orientation of the non-crystalline chains and the degree of crystallinity during extension and relaxation enabled the role of the crystallites in the deformation process to be considered in detail. The intrinsic birefringence of the non-crystalline component was estimated, through the use of the 〈P2(cosα)〉 values obtained from X-ray scattering measurements, to be 0.20±0.02.

Chapter 17: X-Ray rheology of liquid crystal polymers

X-ray Rheology is an experimental technique which uses time-ressolved x-ray scattering as probe of the molecular level structural reorganisation which accompanies flow. It provides quantitative information on the direction alignment and on the level of global orientation. This information is very helpful in interpreting the classic rheological data on liquid crystal polymers. In this research we use data obtained from a cellulose derivate which exhibits a thermotropic liquid crystal phase. We show how increased shear rates lead to a rapid rise in the global orientation and we related this to therories of flow in liquid crystal polymers from the literature. We show that the relaxation time is independent of the prior shear rate.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

A synchrotron powder X-ray diffraction study of the skutterudite-related phases AB1.5Te1.5 (A=Co, Rh, Ir; B= Ge, Sn)

X-ray resonant scattering has been exploited to investigate the crystal structure of the AB1.5Te1.5 phases (A = Co, Rh, Ir; B = Ge, Sn). Analysis of the diffraction data reveals that CoGe1.5Te1.5 and ASn1.5Te1.5 adopt a rhombohedral skutterudite-related structure, containing diamond-shape B2Te2 rings, in which the B and Te atoms are ordered and trans to each other. Anion ordering is however incomplete, and with increasing the size of both cations and anions, the degree of anion ordering decreases. By contrast, the diffraction data of IrGe1.5Te1.5 are consistent with an almost statistical distribution of the anions over the available sites, although some ordered domains may be present. The thermoelectric properties of these materials are discussed in the light of these results.

Non-invasive imaging of roots with high resolution X-ray micro-tomography

ray micro-tomography is a well-established technique for non-invasive imaging and evaluation of heterogeneous materials. An inexpensive X-ray micro-tomography system has been designed and built for the specific purposes of examining root growth and root/soil interactions. The system uses a silver target X-ray source with a focal spot diameter of 80 mum, an X-ray image intensifier with a sampling aperture of about 100 mum, and a sample with a diameter of 25 mm. Pre-germinated wheat and rape seeds were grown for up to 8-10 days in plastic containers in a sandy loam soil sieved to < 250 μm, and imaged with the X-ray system at regular intervals. The quality of 3 D image obtained was good allowing the development and growth of both root axes and some first-order laterals to be observed. The satisfactory discrimination between soil and roots enabled measurements of root diameter (wheat values were 0.48-1.22 mm) in individual tomographic slices and, by tracking from slice to slice, root lengths were also measured. The measurements obtained were generally within 10% of those obtained from destructive samples measured manually and with a flat-bed scanner. Further developments of the system will allow more detailed examination of the root: soil interface.

Measuring root traits in barley (Hordeum vulgare ssp vulgare and ssp spontaneum) seedlings using gel chambers, soil sacs and X-ray microtomography

Root characteristics of seedlings of five different barley genotypes were analysed in 2D using gel chambers, and in 3D using soil sacs that were destructively harvested and pots of soil that were assessed non-invasively using X-ray microtomography. After 5 days, Chime produced the greatest number of root axes (similar to 6) and Mehola significantly less (similar to 4) in all growing methods. Total root length was longest in GSH01915 and shortest in Mehola for all methods, but both total length and average root diameter were significantly larger for plants grown in gel chambers than those grown in soil. The ranking of particular growth traits (root number, root angular spread) of plants grown in gel plates, soil sacs and X-ray pots was similar, but plants grown in the gel chambers had a different order of ranking for root length to the soil-grown plants. Analysis of angles in soil-grown plants showed that Tadmore had the most even spread of individual roots and Chime had a propensity for non-uniform distribution and root clumping. The roots of Mehola were less well spread than the barley cultivars supporting the suggestion that wild and landrace barleys tend to have a narrower angular spread than modern cultivars. The three dimensional analysis of root systems carried out in this study provides insights into the limitations of screening methods for root traits and useful data for modelling root architecture.

An X-ray micro-tomography system optimised for the low-dose study of living organisms

An X-ray micro-tomography system has been designed that is dedicated to the low-dose imaging of radiation sensitive living organisms and has been used to image the early development of the first few days of plant development immediately after germination. The system is based on third-generation X-ray micro-tomography system and consists of an X-ray tube, two-dimensional X-ray detector and a mechanical sample manipulation stage. The X-ray source is a 50 kVp X-ray tube with a silver target with a filter to centre the X-ray spectrum on 22 keV.A 100 mm diameter X-ray image intensifier (XRII) is used to collect the two-dimensional projection images. The rotation tomography table incorporates a linear translation mechanism to eliminate ring artefact that is commonly associated with third-generation tomography systems' Developing maize seeds (Triticum aestivum) have been imaged using the system with a cubic voxel linear dimension of 100 mum, over a diameter of 25 mm and the root lengths and volumes measured. The X-ray dose to the plants was also assessed and found to have no effect on the plant root development. (C) 2003 Elsevier Science Ltd. All rights reserved.

Tracking larval insect movement within soil using high resolution X-ray microtomography

1. In contrast to above-ground insects, comparatively little is known about the behaviour of subterranean insects, due largely to the difficulty of studying them in situ. 2. The movement of newly hatched (neonate) clover root weevil (Sitona lepidus L. Coleoptera: Curculinidae) larvae was studied non-invasively using recently developed high resolution X-ray microtomography. 3. The movement and final position of S. lepidus larvae in the soil was reliably established using X-ray microtomography, when compared with larval positions that were determined by destructively sectioning the soil column. 4. Newly hatched S. lepidus larvae were seen to attack the root rhizobial nodules of their host plant, white clover (Trifolium repens L.). Sitona lepidus larvae travelled between 9 and 27 mm in 9 h at a mean speed of 1.8 mm h(-1). 5. Sitona lepidus larvae did not move through the soil in a linear manner, but changed trajectory in both the lateral and vertical planes.

Preparation and properties of gallaborane, GaBH6: structure of the gaseous molecule H2Ga(μ-H)2BH2 as determined by vibrational, electron diffraction, and ab initio studies, and structure of the crystalline solid at 110 K as determined by x-ray diffraction``

Gallaborane (GaBH6, 1), synthesized by the metathesis of LiBH4 with [H2GaCl]n at ca. 250 K, has been characterized by chemical analysis and by its IR and 1H and 11B NMR spectra. The IR spectrum of the vapor at low pressure implies the presence of only one species, viz. H2Ga(μ-H)2BH2, with a diborane-like structure conforming to C2v symmetry. The structure of this molecule has been determined by gas-phase electron diffraction (GED) measurements afforced by the results of ab initio molecular orbital calculations. Hence the principal distances (rα in Å) and angles ( α in deg) are as follows: r(Ga•••B), 2.197(3); r(Ga−Ht), 1.555(6); r(Ga−Hb), 1.800(6); r(B−Ht), 1.189(7); r(B−Hb), 1.286(7); Hb−Ga−Hb, 71.6(4); and Hb−B−Hb, 110.0(5) (t = terminal, b = bridging). Aggregation of the molecules occurs in the condensed phases. X-ray crystallographic studies of a single crystal at 110 K reveal a polymeric network with helical chains made up of alternating pseudotetrahedral GaH4 and BH4 units linked through single hydrogen bridges; the average Ga•••B distance is now 2.473(7) Å. The compound decomposes in the condensed phases at temperatures exceeding ca. 240 K with the formation of elemental Ga and H2 and B2H6. The reactions with NH3, Me3N, and Me3P are also described.

Barley oxalate oxidase is a hexameric protein related to seed storage proteins: evidence from X-ray crystallography

The oxalate oxidase enzyme expressed in barley roots is a thermostable, protease-resistant enzyme that generates H2O2. It has great medical importance because of its use to assay plasma and urinary oxalate, and it has also been used to generate transgenic, pathogen-resistant crops. This protein has now been purified and three types of crystals grown. X-ray analysis shows that the symmetry present in these crystals is consistent with a hexameric arrangement of subunits, probably a trimer of dimers. This structure may be similar to that found in the related seed storage proteins.

Overproduction, purification and preliminary X-ray diffraction analysis of YncE, an iron-regulated Sec-dependent periplasmic protein from Escherichia coli

The yncE gene of Escherichia coli encodes a predicted periplasmic protein of unknown function. The gene is de-repressed under iron restriction through the action of the global iron regulator Fur. This suggests a role in iron acquisition, which is supported by the presence of the adjacent yncD gene encoding a potential TonB-dependent outer-membrane transporter. Here, the preliminary crystallographic structure of YncE is reported, revealing that it consists of a seven-bladed beta-propeller which resembles the corresponding domain of the `surface-layer protein' of Methanosarcina mazei. A full structure determination is under way in order to provide insight into the function of this protein.