The anharmonic force field of HCN and HCP

The quadratic, cubic, and quartic force field of HCN has been calculated by a least squares refinement to fit the most recent observed data on the vibration-rotation constants of HCN, DCN and H13CN. All of the observed parameters are fitted within their standard errors of observation. The corresponding parameters for other isotopic species are calculated. For HCP and DCP the more limited data available have been fitted to an anharmonic force field using constraints based on comparison with HCN. Using this force field the zero-point rotational constants B0 have been corrected to obtain the equilibrium constants Be, and hence the equilibrium structure has been determined to be re(CH) = 1•0692(7)A, and re(CP) = 1•5398(2)A.

Nitrous acid: vibrational frequency shifts due to 15N substitution, and the harmonic force field

Vibration rotation spectra of HO15 NO and DO15 NO have been measured at a resolution of 0•04 cm-1 to determine the isotopic shifts in the vibrational band origins. These have been used together with recently determined data on the vibrational band origins, Coriolis constants, and centrifugal distorition constants, to determine the harmonic force field of both cis and trans nitrous acid in least squares refinement calculations. The results are discussed in relation to recent ab initio calculations, the inertia defects, and the torsional potential function.

C-H and C-D interbond coupling in CHDCl2

Laser photoacoustic spectra of vapour phase CHDCl2 reveal the presence of an interaction which has been ascribed to interbond coupling between C-H and C-D local modes. The absolute value of the interbond coupling parameter for the CHD group, determined from a fit of a model local mode hamiltonian to the experimental data, is shown to be given approximately by the geometric mean of the interbond coupling parameters of the CH2 and CD2 groups recently derived from similar studies of CH2Cl2 and CD2Cl2. Such behaviour is understood in terms of a simple analysis in which kinetic coupling effects dominate. It is suggested that C-H stretch/bend Fermi resonance is responsible for some weaker features in the spectra and modelling calculations are described which allow an order of magnitude estimate of the size of the coupling parameter involved.

Anharmonicity and local mode effects in the vibrational spectrum of NiCO4 and Co(CO)3NO

Previously published data on the vibrational fundamentals and overtones of the carbonyl stretching modes of Ni(CO)4 and Co(CO)3NO are reinterpreted using the recent model of Mills and Robiette, including Darling-Dennison resonances and local mode effects. The harmonic wavenumber θm and anharmonicity constant xm associated with the carbonyl and nitrosyl stretching modes are derived, and the 13C and 18O isotopic shifts are discussed in relation to the harmonic and anharmonic force field.

Self-activation and out-group contrast

It has been suggested that higher in-group identifiers primed with an out-group stereotype show contrastive behavioral responses because they activate the in-group, social-self. However, priming the personal-self can lead to contrastive judgments. We investigated whether personal self-activation was also evident for higher identifiers primed with an out-group. An experiment demonstrated that higher identifiers primed with an out-group showed faster responses to self-words than higher identifiers primed with the in-group. This findings suggest that the personal-self is also activated for higher identifiers primed with an out-group, and this self-activation may underlie their contrastive responding.

Understanding of auditory discourse in older adults: the effects of syntax and working memory

Background: As people age, language-processing ability changes. While several factors modify discourse comprehension ability in older adults, syntactic complexity of auditory discourse has received scant attention. This is despite the widely researched domain of syntactic processing of single sentences in older adults. Aims: The aims of this study were to investigate the ability of healthy older adults to understand stories that differed in syntactic complexity, and its relation to working memory. Methods & Procedures: A total of 51 healthy adults (divided into three age groups) took part. They listened to brief stories (syntactically simple and syntactically complex) and had to respond to false/true comprehension probes following each story. Working memory capacity (digit span, forward and backward) was also measured. Outcomes & Results: Differences were found in the ability of healthy older adults to understand simple and complex discourse. The complex discourse in particular was more sensitive in discerning age-related language patterns. Only the complex discourse task correlated moderately with age. There was no correlation between age and simple discourse. As far as working memory is concerned, moderate correlations were found between working memory and complex discourse. Education did not correlate with discourse, neither simple, nor complex. Conclusions: Older adults may be less efficient in forming syntactically complex representations and this may be influenced by limitations in working memory.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.