23 resultados para Substrats de NaCl
Resumo:
A Gram-negative, aerobic to microaerophilic rod was isolated from 10 m depths of the hypersaline, heliothermal and meromictic Ekho Lake (East Antarctica). The strain was oxidase- and catalase-positive, metabolized a variety of carboxylic acids and sugars and produced lipase. Cells had an absolute requirement for artificial sea water, which could not be replaced by NaCl. A large in vivo absorption band at 870 nm indicated production of bacteriochlorophyll a. The predominant fatty acids of this organism were 16:0 and 18:1omega7c, with 3-OH 10:0, 16:1omega7c and 18:0 in lower amounts. The main polar lipids were diphosphatidylglycerol, phosphatidylglycerol and phosphatidylcholine. Ubiquinone 10 was produced. The DNA G + C content was 67 mol%. 16S rRNA gene sequence comparisons indicated that the isolate represents a member of the Roseobacter clade within the alpha-Proteobacteria. The organism showed no particular relationship to any members of this clade but clustered on the periphery of the genera Jannaschia, Octadecabacter and 'Marinosulfonomonas' and the species Ruegeria gelatinovorans. Distinct morphological, physiological and genotypic differences to these previously described taxa supported the description of a new genus and a novel species, for which the name Roseisalinus antarcticus gen. nov., sp. nov. is proposed. The type strain is EL-88(T) (= DSM 11466(T) = CECT 7023(T)).
Resumo:
A whey salts mixture was used as a partial substitute for sodium chloride to provide a modified Na:K ratio (1:3.4) in the manufacture of white salted cheese using ultrafiltration. Reduction of chymosin addition from 20 to 8 mu L kg(-1) of cheese was also investigated. Variation of salt and chymosin levels did not result in any significant differences in composition and physicochemical properties. The rates of proteolysis in terms of water-soluble nitrogen (WSN) and nitrogen soluble in 12% trichloroacetic acid (TCA-SN) were affected by chymosin levels but not by salt treatment. Urea-PAGE electrophoretic analysis of caseins from the cheeses manufactured using three levels of chymosin and two salt types showed that the hydrolysis of alpha(s1)-casein was higher than for beta-caseins but the differences between the cheeses were not significant (P > 0.05). The chymosin level did not have a significant effect (P > 0.05) on hardness and fracturability, suggesting that any variation in hardness due to the initial hydrolysis was being confounded by other variables. Cheeses including the whey salts product were harder and more fracturable (P < 0.01) than the cheese treated with NaCl only. Both hardness and fracturability values decreased (P < 0.05) over the maturation period. The scores for bitterness were low; neither the effects of salt nor chymosin levels were significant (P > 0.05). (c) 2005 Elsevier Ltd. All rights reserved.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
We study the effects of NaCl on the self-assembly of AAKLVFF and beta A beta AKLVFF in solution. Both AAKLVFF and beta A beta AKLVFF self-assemble into twisted fibers in aqueous solution. The addition of NaCl to aqueous solutions of AAKLVFF produces large crystal-like nanotapes which eventually precipitate. In contrast, highly twisted fibrils were observed for beta A beta AKLVFF solutions at low salt concentration, while a coexistence of highly twisted fibers and nanotubes was observed for beta A beta AKLVFF at high salt concentration. The self-assembled structures observed for beta A beta AKLVFF in NaCl solutions were ascribed to the progressive screening of the beta A beta AKLVFF surface charge caused by the addition of salt.
Resumo:
We use atomistic molecular dynamics simulations to probe the effects of added sodium chloride (NaCl) and sodium salicylate (NaSal) salts on the spherical-to-threadlike micelle shape transition in aqueous solutions of cetyltrimethylammonium chloride (CTAC) surfactants. Long threadlike micelles are found to be unstable and break into spherical micelles at low concentrations or NaCl, but remain stable for 20 ns above a threshold value of [NaCl] approximate to 3.0 M, which is about 2.5 times larger than the experimental salt concentration at which the transition between spherical and rodlike micelles occurs. The chloride counterions associate weakly oil the surface of the CTAC micelles with the degree of counterion dissociation decreasing slightly with increasing [NaCl] on spherical micelles, but dropping significantly on the threadlike micelles tit high [NaCl]. This effect indicates that the electrolyte ions drive the micellar shape transition by screening the electrostatic repulsions between the micellar headgroups, The aromatic salicylate counterions, on the other hand, penetrate inside the micelle with their hydrophilic groups staying in the surfactant headgroup region and the hydrophobic groups partially embedded into the hydrophobic core of the micelle. The strong association of the salicylate ions with the surfactant headgroups leads to dense packing of the surfactant molecules, which effectively reduces the surface area per surfactant, and increases intramicellar ordering of the surfactant headgroups, favoring the formation of long threadlike micelles. Simulation predictions of the geometric and electrostatic properties of the spherical and threadlike micelles are in good agreement with experiments.
Resumo:
Sigma B (σB) is an alternative sigma factor that controls the transcriptional response to stress in Listeria monocytogenes and is also known to play a role in the virulence of this human pathogen. In the present study we investigated the impact of a sigB deletion on the proteome of L. monocytogenes grown in a chemically defined medium both in the presence and in the absence of osmotic stress (0.5 M NaCl). Two new phenotypes associated with the sigB deletion were identified using this medium. (i) Unexpectedly, the strain with the ΔsigB deletion was found to grow faster than the parent strain in the growth medium, but only when 0.5 M NaCl was present. This phenomenon was independent of the carbon source provided in the medium. (ii) The ΔsigB mutant was found to have unusual Gram staining properties compared to the parent, suggesting that σB contributes to the maintenance of an intact cell wall. A proteomic analysis was performed by two-dimensional gel electrophoresis, using cells growing in the exponential and stationary phases. Overall, 11 proteins were found to be differentially expressed in the wild type and the ΔsigB mutant; 10 of these proteins were expressed at lower levels in the mutant, and 1 was overexpressed in the mutant. All 11 proteins were identified by tandem mass spectrometry, and putative functions were assigned based on homology to proteins from other bacteria. Five proteins had putative functions related to carbon utilization (Lmo0539, Lmo0783, Lmo0913, Lmo1830, and Lmo2696), while three proteins were similar to proteins whose functions are unknown but that are known to be stress inducible (Lmo0796, Lmo2391, and Lmo2748). To gain further insight into the role of σB in L. monocytogenes, we deleted the genes encoding four of the proteins, lmo0796, lmo0913, lmo2391, and lmo2748. Phenotypic characterization of the mutants revealed that Lmo2748 plays a role in osmotolerance, while Lmo0796, Lmo0913, and Lmo2391 were all implicated in acid stress tolerance to various degrees. Invasion assays performed with Caco-2 cells indicated that none of the four genes was required for mammalian cell invasion. Microscopic analysis suggested that loss of Lmo2748 might contribute to the cell wall defect observed in the ΔsigB mutant. Overall, this study highlighted two new phenotypes associated with the loss of σB. It also demonstrated clear roles for σB in both osmotic and low-pH stress tolerance and identified specific components of the σB regulon that contribute to the responses observed.
Resumo:
Multiple exposures have been shown to increase preference for novel foods or flavours. This "mere exposure" effect is also well known anecdotally for changes in preference for tastants within foods, for example reducing sugar in tea or coffee. However, to date, this phenomenon has received little scientific attention. The present study addressed this issue in relation to changes in preference for salt within soup. Following an initial assessment of liking, familiarity and saltiness of six soups varying in salt content (0 - 337 mg NaCl/ml), thirty-seven participants, previously assessed for their preferred salt level in soup, were allocated to either an exposure group that received 20 ml soup samples with no added salt, to a group that received a 280 ml bowl of this soup, or to a control group that received 20 ml soup samples containing salt at 280mg/100g (within normal, commercial range). Soups were presented on eight occasions, at approximately daily intervals. The two groups receiving the no added salt soup showed increases in liking starting at the third exposure, and also evident in a repeat assessment following the exposures. Increases in familiarity of the no added salt soup were also evident during exposure. Rated saltiness of all soups increased as a function of exposure, so a change in saltiness perception could not account for changes in liking for just the no added salt soups. These data suggest that simple exposure to the taste of the no added salt soup was sufficient to increase liking to a level equivalent to the initially more preferred salt level.
Resumo:
SB203580 is a recognised inhibitor of p38-MAPKs. Here, we investigated the effects of SB203580 on cardiac SAPKs/JNKs. The IC50 for inhibition of p38-MAPK stimulation of MAPKAPK2 was approximately 0.07 microM, whereas that for total SAPK/JNK activity was 3-10 microM. SB203580 did not inhibit immunoprecipitated JNK1 isoforms. Three peaks of SAPK/JNK activity were separated by anion exchange chromatography, eluting in the isocratic wash (44 kDa), and at 0.08 M (46 and 52 kDa) and 0.15 M NaCl (54 kDa). SB203580 (10 microM) completely inhibited the 0.15 M NaCl activity and partially inhibited the 0.08 M NaCl activity. Since JNK1 antibodies immunoprecipitate the 46 kDa activity, this indicates that SB203580 selectively inhibits 52 and 54 kDa SAPKs/JNKs.