39 resultados para Quartz crystals


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Single crystals of trans-cinnamic acid and of a range of derivatives of this compound containing halogen substituents on the aromatic ring have been reacted with 165 Torr pressure of bromine vapour in a sealed desiccator at 20 degrees C for 1 week. Infrared and Raman microspectroscopic examination of the crystals shows that bromination of the aliphatic double bond, but not of the aromatic ring, has occurred. It is demonstrated also that the reaction is truly gas-solid in nature. A time-dependent study of these reactions shows that they do not follow a smooth diffusion-controlled pathway. Rather the reactions appear to be inhomogeneous and to occur at defects within the crystal. The reaction products are seen to flake from the surface of the crystal. It is shown, therefore, that these are not single crystal to single crystal transitions, as have been observed previously for the photodimerisation of trans-cinnamic acid and several of its derivatives. It is shown that there are no by-products of the reaction and that finely ground samples react to form the same products as single crystals.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Nanofilm deposits of TiO2 nanoparticle phytates are formed on gold electrode surfaces by 'directed assembly' methods. Alternate exposure of a 3-mercapto-propionic acid modified gold surface to (i) a TiO2 sol and (ii) an aqueous phytic acid solution (pH 3) results in layer-by-layer formation of a mesoporous film. Ru(NH3)(6)(3+) is shown to strongly adsorb/accumulate into the mesoporous structure whilst remaining electrochemically active. Scanning the electrode potential into a sufficiently negative potential range allows the Ru(NH3)(6)(3+) complex to be reduced to Ru(NH3)(6)(2+) which undergoes immediate desorption. When applied to a gold coated quartz crystal microbalance (QCM) sensor, electrochemically driven adsorption and desorption processes in the mesoporous structure become directly detectable as a frequency response, which corresponds directly to a mass or density change in the membrane. The frequency response (at least for thin films) is proportional to the thickness of the mass-responsive film, which suggests good mechanical coupling between electrode and film. Based on this observation, a method for the amplified QCM detection of small mass/density changes is proposed by conducting measurements in rigid mesoporous structures. (C) 2003 Elsevier Science B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A chemically coated piezoelectric sensor has been developed for the determination of PAHs in the liquid phase. An organic monolayer attached to the surface of a gold electrode of a quartz crystal microbalance (QCM) via a covalent thiol-gold link complete with an ionically bound recognition element has been produced. This study has employed the PAH derivative 9-anthracene carboxylic acid which, once bound to the alkane thiol, functions as the recognition element. Binding of anthracene via pi-pi interaction has been observed as a frequency shift in the QCM with a detectability of the target analyte of 2 ppb and a response range of 0-50 ppb. The relative response of the sensor altered for different PAHs despite pi-pi interaction being the sole communication between recognition element and analyte. It is envisaged that such a sensor could be employed in the identification of key marker compounds and, as such, give an indication of total PAH flux in the environment.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Reactions in (molecular) organic crystalline solids have been shown to be important for exerting control that is unattainable over chemical transformations in solution. Such control has also been achieved for reactions within metal– organic cages. In these examples, the reactants are already in place within the crystals following the original crystal growth. The post-synthetic modification of metal–organic frameworks (MOFs and indeed reactions and catalysis within MOFs have been recently demonstrated; in these cases the reactants enter the crystals through permanent channels. Another growing area of interest within molecular solid-state chemistry is synthesis by mechanical co-grinding of solid reactants—often referred to as mechanochemistry. Finally, in a small number of reported examples, molecules also have been shown to enter nonporous crystals directly from the gas or vapor phase, but in only a few of these examples does a change in covalent bonding result, which indicates that a reaction occurs within the nonporous crystals. It is this latter type of highly uncommon reaction that is the focus of the present study.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The synthesis of a dithiol-functionalized pyrene derivative is reported, together with studies of interactions between this receptor (and other related pyrenes) and nitroaromatic compounds (NACs), in both solution and in the solid state. Spectroscopic analysis in solution and X-ray crystallographic analysis of cocrystals of pyrene and NACs in the solid state indicate that supramolecular interactions lead to the formation of defined pi-pi stacked complexes. The dithiolfunctionalized pyrene derivative can be used to modify the surface of a gold quartz crystal microbalance (QCM) to create a unique π-electron rich surface, which is able to interact with electron poor aromatic compounds. For example, exposure of the modified QCM surface to the nitroaromatic compound 2,4-dinitrotoluene (DNT) in solution results in a reduction in the resonant frequency of the QCM as a result of supramolecular interactions between the electron-rich pyrenyl surface layer and the electron-poor DNT molecules. These results suggest the potential use of such modified QCM surfaces for the detection of explosive NACs.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The physical and empirical relationships used by microphysics schemes to control the rate at which vapor is transferred to ice crystals growing in supercooled clouds are compared with laboratory data to evaluate the realism of various model formulations. Ice crystal growth rates predicted from capacitance theory are compared with measurements from three independent laboratory studies. When the growth is diffusion- limited, the predicted growth rates are consistent with the measured values to within about 20% in 14 of the experiments analyzed, over the temperature range −2.5° to −22°C. Only two experiments showed significant disagreement with theory (growth rate overestimated by about 30%–40% at −3.7° and −10.6°C). Growth predictions using various ventilation factor parameterizations were also calculated and compared with supercooled wind tunnel data. It was found that neither of the standard parameterizations used for ventilation adequately described both needle and dendrite growth; however, by choosing habit-specific ventilation factors from previous numerical work it was possible to match the experimental data in both regimes. The relationships between crystal mass, capacitance, and fall velocity were investigated based on the laboratory data. It was found that for a given crystal size the capacitance was significantly overestimated by two of the microphysics schemes considered here, yet for a given crystal mass the growth rate was underestimated by those same schemes because of unrealistic mass/size assumptions. The fall speed for a given capacitance (controlling the residence time of a crystal in the supercooled layer relative to its effectiveness as a vapor sink, and the relative importance of ventilation effects) was found to be overpredicted by all the schemes in which fallout is permitted, implying that the modeled crystals reside for too short a time within the cloud layer and that the parameterized ventilation effect is too strong.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Experiments were performed to investigate the evolution of structure and morphology of the network in polymer-stabilised liquid crystals. In situ optical microscopy revealed that the morphology was significantly altered by extraction of the LC host, while scanning electron microscopy showed that the network morphology was also dependent on the polymerisation conditions and closely related to the depletion of monomer, as monitored by high performance liquid chromatography. Transmission electron microscopy allowed observation of internal structure, resolving microstructure on the order of 0. 1 μm.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Polymer-stabilised liquid crystals are systems in which a small amount of monomer is dissolved within a liquid crystalline host, and then polymerised in situ to produce a network. The progress of the polymerisation, performed within electro-optic cells, was studied by establishing an analytical method novel to these systems. Samples were prepared by photopolymerisation of the monomer under well-defined reaction conditions; subsequent immersion in acetone caused the host and any unreacted monomer to dissolve. High performance liquid chromatography was used to separate and detect the various solutes in the resulting solutions, enabling the amount of unreacted monomer for a given set of conditions to be quantified. Longer irradiations cause a decrease in the proportion of unreacted monomer since more network is formed, while a more uniform LC director alignment (achieved by decreasing the sample thickness) or a higher level of order (achieved by decreasing the polymerisation temperature) promotes faster reactions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The effect of irradiation (UV-visible light) on a nematic liquid crystal doped with a photoactive azobenzene derivative was investigated. The selective irradiation results in either an E implies Z or Z implies E isomerization of the azobenzene unit. The effect of the isomerization is to cause a reversible depression of the liquid crystal to isotropic (LC implies l) phase transition temperature of the doped mixture, which can be monitored optically as an isothermal phase transition. This depression also results in a biphasic liquid crystal+isotropic region which is discussed. The authors investigate the cause and magnitude of the phase depression as a function of the amount of doped 4-butyl-4'-methoxyazobenzene (photoactive unit) in 4-cyano-4'-n-pentylbiphenyl (liquid crystal unit), and as a function of the percentage conversion of E implies Z (caused by isomerization) in the azobenzene. The photostationary state of the doped mixtures achieved by Z implies E isomerization is considered and its effect upon the transition temperature of the mixture and response time of the system is discussed. They discuss the implications of the photostationary state with regards to the reversibility of the photo-induced phase transition and hence potential applications.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Side chain liquid crystal polymers and elastomers exhibit a rich phase behaviour which arises from the antagonistic influences of the entropically disordered polymer chain configuration and the long range orientational ordering of the mesogenic units. This competition arises since the natural macroscopic phase separation is inhibited by the inherent chemical connectivity of the system. At the heart of this connectivity is the spacer link and we consider here its influence on the phase behaviour. In particular we consider a series of elastomers in which the number of alkyl units in the spacer is systematically varied from 2 to 6. The lengthening of the coupling spacer is accompanied by an alternation of the sign of coupling between the polymer chain and the mesogenic unit. These results demonstrate the dominating influence of the so-called hinge effect in determining the phase behaviour. In addition to the alternation of the sign there is some decrease in the magnitude of the coupling with increasing spacer length.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Global molecular orientation function coefficients for the nematic liquid crystal 4-cyano 4'-nn -pentylbiphenyl (5CB) in shear flow are presented, being extracted from 2-dimensional Wide-Angle X-ray Scattering data. A linear increase in orientation parameter P2 is observed with a logarithmic increase in shear rate. It is proposed that this arises from an increased number of LC directors aligning to the shear axis. Upon cessation of shear flow, the anisotropy is seen to relax away completely, over a time scale which is inversely proportional to the previously applied shear rate.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The single scattering albedo w_0l in atmospheric radiative transfer is the ratio of the scattering coefficient to the extinction coefficient. For cloud water droplets both the scattering and absorption coefficients, thus the single scattering albedo, are functions of wavelength l and droplet size r. This note shows that for water droplets at weakly absorbing wavelengths, the ratio w_0l(r)/w_0l(r0) of two single scattering albedo spectra is a linear function of w_0l(r). The slope and intercept of the linear function are wavelength independent and sum to unity. This relationship allows for a representation of any single scattering albedo spectrum w_0l(r) via one known spectrum w_0l(r0). We provide a simple physical explanation of the discovered relationship. Similar linear relationships were found for the single scattering albedo spectra of non-spherical ice crystals.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Crystal engineering principles were used to design three new co-crystals of paracetamol. A variety of potential cocrystal formers were initially identified from a search of the Cambridge Structural Database for molecules with complementary hydrogen-bond forming functionalities. Subsequent screening by powder X-ray diffraction of the products of the reaction of this library of molecules with paracetamol led to the discovery of new binary crystalline phases of paracetamol with trans-1,4- diaminocyclohexane (1); trans-1,4-di(4-pyridyl)ethylene (2); and 1,2-bis(4-pyridyl)ethane (3). The co-crystals were characterized by IR spectroscopy, differential scanning calorimetry, and 1H NMR spectroscopy. Single crystal X-ray structure analysis reveals that in all three co-crystals the co-crystal formers (CCF) are hydrogen bonded to the paracetamol molecules through O−H···N interactions. In co-crystals (1) and (2) the CCFs are interleaved between the chains of paracetamol molecules, while in co-crystal (3) there is an additional N−H···N hydrogen bond between the two components. A hierarchy of hydrogen bond formation is observed in which the best donor in the system, the phenolic O−H group of paracetamol, is preferentially hydrogen bonded to the best acceptor, the basic nitrogen atom of the co-crystal former. The geometric aspects of the hydrogen bonds in co-crystals 1−3 are discussed in terms of their electrostatic and charge-transfer components.