59 resultados para New dimensions of security in Central and Northeastern Europe


Relevância:

100.00% 100.00%

Publicador:

Resumo:

DFT and TD-DFT calculations (ADF program) were performed in order to analyze the electronic structure of the [M-3(CO)(12)] clusters (M = Ru, Os) and interpret their electronic spectra. The highest occupied molecular orbitals are M-M bonding (sigma) involving different M-M bonds, both for Ru and Os. They participate in low-energy excitation processes and their depopulation should weaken M-M bonds in general. While the LUMO is M-NI and M-CO anti-bonding (sigma*), the next, higher-lying empty orbitals have a main contribution from CO (pi*) and either a small (Ru) or an almost negligible one (Os) from the metal atoms. The main difference between the two clusters comes from the different nature of these low-energy unoccupied orbitals that have a larger metal contribution in the case of ruthenium. The photochemical reactivity of the two clusters is reexamined and compared to earlier interpretations.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This paper reports the proceedings of a conference held at Reading University in 1993 which addressed the issues of new technological developments at the regional and sub-regional levels in Britain and France. These new technological clusters - the `Technopoles' - are investigated in a series of papers in both English and French which examines their spatial, sectoral and economic aspects to determine what lessons can be learned from their development and what their future economic significance is likely to be. Two recurring themes are of particular significance in the papers - the link between R& D and regional development, and the different forms which innovation assumes within the various technopoles under scrutiny.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The impending threat of global climate change and its regional manifestations is among the most important and urgent problems facing humanity. Society needs accurate and reliable estimates of changes in the probability of regional weather variations to develop science-based adaptation and mitigation strategies. Recent advances in weather prediction and in our understanding and ability to model the climate system suggest that it is both necessary and possible to revolutionize climate prediction to meet these societal needs. However, the scientific workforce and the computational capability required to bring about such a revolution is not available in any single nation. Motivated by the success of internationally funded infrastructure in other areas of science, this paper argues that, because of the complexity of the climate system, and because the regional manifestations of climate change are mainly through changes in the statistics of regional weather variations, the scientific and computational requirements to predict its behavior reliably are so enormous that the nations of the world should create a small number of multinational high-performance computing facilities dedicated to the grand challenges of developing the capabilities to predict climate variability and change on both global and regional scales over the coming decades. Such facilities will play a key role in the development of next-generation climate models, build global capacity in climate research, nurture a highly trained workforce, and engage the global user community, policy-makers, and stakeholders. We recommend the creation of a small number of multinational facilities with computer capability at each facility of about 20 peta-flops in the near term, about 200 petaflops within five years, and 1 exaflop by the end of the next decade. Each facility should have sufficient scientific workforce to develop and maintain the software and data analysis infrastructure. Such facilities will enable questions of what resolution, both horizontal and vertical, in atmospheric and ocean models, is necessary for more confident predictions at the regional and local level. Current limitations in computing power have placed severe limitations on such an investigation, which is now badly needed. These facilities will also provide the world's scientists with the computational laboratories for fundamental research on weather–climate interactions using 1-km resolution models and on atmospheric, terrestrial, cryospheric, and oceanic processes at even finer scales. Each facility should have enabling infrastructure including hardware, software, and data analysis support, and scientific capacity to interact with the national centers and other visitors. This will accelerate our understanding of how the climate system works and how to model it. It will ultimately enable the climate community to provide society with climate predictions, which are based on our best knowledge of science and the most advanced technology.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Bushmeat is a large but largely invisible contributor to the economies of west and central African countries. Yet the trade is currently unsustainable. Hunting is reducing wildlife populations, driving more vulnerable species to local and regional extinction, and threatening biodiversity. This paper uses a commodity chain approach to explore the bushmeat trade and to demonstrate why an interdisciplinary approach is required if the trade is to be sustainable in the future.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Recent concerns over the valuation process in collective leasehold enfranchisement and lease extension cases have culminated in new legislation. To underpin this, the Government (Department of Environment Transport and the Regions (DETR)) commissioned new research, which examined whether the valuation of the freehold in such cases could be simplified through the prescription of either yield or marriage value/relativity. This paper, which is based on that research, examines whether it is possible or desirable to prescribe such factors in the valuation process. Market, settlement and Local Valuation Tribunal (LVT) decisions are analysed, and the basis of 'relativity charts' used in practice is critically examined. Ultimately the imperfect nature of the market in freehold investment sales and leasehold vacant possession sales means that recommendations must rest on an analysis of LVT data. New relativity curves are developed from this data and used in conjunction with an alternative approach to valuation yields (based on other investment assets). However, the paper concludes that although the prescription of yields and relativity is possible, it is not fully defensible because of problems in determining risk premia; that the evidential basis for relativity consists of LVT decisions; and that a formula approach would tend to 'lead' the market as a whole.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Various food and feed samples including groundnut seed, maize, sorghum, soyabean cake, groundnut cake, cotton cake, poultry feed, buffalo milk, cow milk and milk powders were collected from farmers' fields, farmer's stores, oil millers storage, traders' storage, retail shops and supermarkets. More than 2000 samples were analysed by ELISA and most of the commodities, with the exception of sorghum seed, contained high levels of aflatoxin. Groundnut cake was one of the major cattle feed ingredients in the peri-urban area of Hyderabad (Andhra Pradesh, India) and >75% of the samples contained >100 µg/kg aflatoxin, leading to a high level of aflatoxin M1, in milk samples. Strategies to reduce aflatoxin levels (especially in groundnut) by management interventions at preharvest, harvest and storage, are discussed.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Objectives: Myostatin, a member of the transforming growth factor-beta (TGF-beta) family, plays a key role in skeletal muscle myogenesis by limiting hyperplastic and hypertrophic muscle growth. In cardiac muscle, myostatin has been shown to limit agonist-induced cardiac hypertrophic growth. However, its role in cardiac hyperplastic growth remains undetermined. The aim of this study was to characterise the expression of myostatin in developing myocardium, determine its effect on cardiomyocyte proliferation, and explore the signalling mechanisms affected by myostatin in dividing cardiomyocytes. Methods: We used quantitative PCR and Western blotting to study the expression of myostatin in cardiomyocytes isolated from rat myocardium at different developmental ages. We. determined the effect of recombinant myostatin on proliferation and cell viability in dividing cardiomyocytes in culture. We analysed myostatin's effect on cardiomyocyte cell cycle progression by flow cytometry and used Western blotting to explore the signalling mechanisms involved. Results: Myostatin is expressed differentially in cardiomyocytes during cardiac development such that increasing expression correlated with a low cardiomyocyte proliferation index. Proliferating foetal cardiomyocytes, from embryos at 18 days of gestation, expressed low levels of myostatin mRNA and protein, whereas isolated cardiomyocytes from postnatal day 10 hearts, wherein the majority of cardiomyocytes have lost their ability to proliferate, displayed a 6-fold increase in myostatin expression. Our in vitro studies demonstrated that myostatin inhibited proliferation of dividing foetal and neonatal cardiomyocytes. Flow cytometric analysis showed that this inhibition occurs mainly via a block in the G1-S phase transition of the cardiomyocyte cell cycle. Western blot analysis showed that part of the mechanism underpinning the inhibition of cardiomyocyte proliferation by myostatin involves phosphorylation of SMAD2 and altered expressions of the cell cycle proteins p21 and CDK2. Conclusions: We conclude that myostatin is an inhibitor of cardiomyocyte proliferation with the potential to limit cardiomyocyte hyperplastic growth by altering cardiac cell cycle progression. (c) 2007 European Society of Cardiology. Published by Elsevier B.V. All fights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Many different reagents and methodologies have been utilised for the modification of synthetic and biological macromolecular systems. In addition, an area of intense research at present is the construction of hybrid biosynthetic polymers, comprised of biologically active species immobilised or complexed with synthetic polymers. One of the most useful and widely applicable techniques available for functionalisation of macromolecular systems involves indiscriminate carbene insertion processes. The highly reactive and non-specific nature of carbenes has enabled a multitude of macromolecular structures to be functionalised without the need for specialised reagents or additives. The use of diazirines as stable carbene precursors has increased dramatically over the past twenty years and these reagents are fast becoming the most popular photophors for photoaffinity labelling and biological applications in which covalent modification of macromolecular structures is the basis to understanding structure-activity relationships. This review reports the synthesis and application of a diverse range of diazirines in macromolecular systems.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Innovation is notoriously difficult to define and is invariably intertwined with issues of knowledge creation, continuous improvement and organisational change. An extensive literature classifies numerous types of innovation and militates against any simplistic attempt at definition. It is widely accepted that innovation is at least partly dependent upon the surrounding environment. Industry recipes and institutionally embedded practices shape the environment within which innovation occurs. Recent research directions have addressed the diffusion of innovation and its dependence upon social and institutional structures. In this respect, it is highly pertinent to compare the way that innovation is interpreted and enacted in different industrial sectors. The comparison between UK aerospace and construction is especially revealing because the two sectors are so different and therefore constitute radically different climates for innovation. Empirical research is reported based on semi-structured interviews with practitioners from both sectors. Interpretations of innovation are found to differ dramatically between aerospace and construction. Within the context of an ongoing struggle to define innovation, both industries are striving to become more innovative. The aerospace sector is found to emphasise technical innovation whereas the construction sector emphasises process innovation. An overriding cultural bias in Western economies towards technological innovation results in the common perception that aerospace is much more innovative than construction. The experienced realities of practitioners in the two sectors are much more complex.

Relevância:

100.00% 100.00%

Publicador:

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This paper provides an overview of analytical techniques used to determine isoflavones (IFs) in foods and biological fluids with main emphasis on sample preparation methods. Factors influencing the content of IFs in food including processing and natural variability are summarized and an insight into IF databases is given. Comparisons of dietary intake of IFs in Asian and Western populations, in special subgroups like vegetarians, vegans, and infants are made and our knowledge on their absorption, distribution, metabolism, and excretion by the human body is presented. The influences of the gut microflora, age, gender, background diet, food matrix, and the chemical nature of the IFs on the metabolism of IFs are described. Potential mechanisms by which IFs may exert their actions are reviewed, and genetic polymorphism as determinants of biological response to soy IFs is discussed. The effects of IFs on a range of health outcomes including atherosclerosis, breast, intestinal, and prostate cancers, menopausal symptoms, bone health, and cognition are reviewed on the basis of the available in vitro, in vivo animal and human data.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Carotenoids are a class of natural pigments familiar to all through the orange-red to yellow colors of many fruits, vegetables, and flowers, as well as for the provitamin A activity that some of them possess. A body of scientific evidence suggests that carotenoids may scavenge and deactivate free radicals, acting thereby as antioxidants both in food systems (in vitro) and in the human organism (in vivo). Overall, epidemiological evidence links higher carotenoid intakes and tissue concentrations with reduced cancer and cardiovascular disease risk. However, research has also shown that the antioxidant activity of carotenoids may shift to a prooxidant character depending mainly on the biological environment in which they act. A summary of the antioxidant potential of natural carotenoids both in oil model systems and in vivo is presented in this article.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.