On spectral invariance of single scattering albedo for water droplets and ice crystals at weakly absorbing wavelengths

The single scattering albedo w_0l in atmospheric radiative transfer is the ratio of the scattering coefficient to the extinction coefficient. For cloud water droplets both the scattering and absorption coefficients, thus the single scattering albedo, are functions of wavelength l and droplet size r. This note shows that for water droplets at weakly absorbing wavelengths, the ratio w_0l(r)/w_0l(r0) of two single scattering albedo spectra is a linear function of w_0l(r). The slope and intercept of the linear function are wavelength independent and sum to unity. This relationship allows for a representation of any single scattering albedo spectrum w_0l(r) via one known spectrum w_0l(r0). We provide a simple physical explanation of the discovered relationship. Similar linear relationships were found for the single scattering albedo spectra of non-spherical ice crystals.

Quantitative single-molecule localization microscopy combined with rule-based modeling reveals ligand-induced TNF-R1 reorganization toward higher-order oligomers

We report on the assembly of tumor necrosis factor receptor 1 (TNF-R1) prior to ligand activation and its ligand-induced reorganization at the cell membrane. We apply single-molecule localization microscopy to obtain quantitative information on receptor cluster sizes and copy numbers. Our data suggest a dimeric pre-assembly of TNF-R1, as well as receptor reorganization toward higher oligomeric states with stable populations comprising three to six TNF-R1. Our experimental results directly serve as input parameters for computational modeling of the ligand-receptor interaction. Simulations corroborate the experimental finding of higher-order oligomeric states. This work is a first demonstration how quantitative, super-resolution and advanced microscopy can be used for systems biology approaches at the single-molecule and single-cell level.

Electrochemical single-molecule transistors with optimized gate coupling

Electrochemical gating at the single molecule level of viologen molecular bridges in ionic liquids is examined. Contrary to previous data recorded in aqueous electrolytes, a clear and sharp peak in the single molecule conductance versus electrochemical potential data is obtained in ionic liquids. These data are rationalized in terms of a two-step electrochemical model for charge transport across the redox bridge. In this model the gate coupling in the ionic liquid is found to be fully effective with a modeled gate coupling parameter, ξ, of unity. This compares to a much lower gate coupling parameter of 0.2 for the equivalent aqueous gating system. This study shows that ionic liquids are far more effective media for gating the conductance of single molecules than either solid-state three-terminal platforms created using nanolithography, or aqueous media.

Preparation and properties of gallaborane, GaBH6: structure of the gaseous molecule H2Ga(μ-H)2BH2 as determined by vibrational, electron diffraction, and ab initio studies, and structure of the crystalline solid at 110 K as determined by x-ray diffraction``

Gallaborane (GaBH6, 1), synthesized by the metathesis of LiBH4 with [H2GaCl]n at ca. 250 K, has been characterized by chemical analysis and by its IR and 1H and 11B NMR spectra. The IR spectrum of the vapor at low pressure implies the presence of only one species, viz. H2Ga(μ-H)2BH2, with a diborane-like structure conforming to C2v symmetry. The structure of this molecule has been determined by gas-phase electron diffraction (GED) measurements afforced by the results of ab initio molecular orbital calculations. Hence the principal distances (rα in Å) and angles ( α in deg) are as follows: r(Ga•••B), 2.197(3); r(Ga−Ht), 1.555(6); r(Ga−Hb), 1.800(6); r(B−Ht), 1.189(7); r(B−Hb), 1.286(7); Hb−Ga−Hb, 71.6(4); and Hb−B−Hb, 110.0(5) (t = terminal, b = bridging). Aggregation of the molecules occurs in the condensed phases. X-ray crystallographic studies of a single crystal at 110 K reveal a polymeric network with helical chains made up of alternating pseudotetrahedral GaH4 and BH4 units linked through single hydrogen bridges; the average Ga•••B distance is now 2.473(7) Å. The compound decomposes in the condensed phases at temperatures exceeding ca. 240 K with the formation of elemental Ga and H2 and B2H6. The reactions with NH3, Me3N, and Me3P are also described.

Novel single chain antibodies to the prion protein identified by phage display

A well defined structure is available for the carboxyl half of the cellular prion protein (PrPc), while the structure of the amino terminal half of the molecule remains ill defined. The unstructured nature of the polypeptide has meant that relatively few of the many antibodies generated against PrPc recognise this region. To circumvent this problem, we have used a previously characterised and well expressed fragment derived from the amino terminus of PrPc as bait for panning a single chain antibody phage (scFv-P) library. Using this approach, we identified and characterised I predominant and 3 additional scFv-Ps that contained different V-H and V-L sequences and that bound specifically to the PrPc target. Epitope mapping revealed that all scFv-Ps recognised linear epitopes between PrPc residues 76 and 156. When compared with existing monoclonal antibodies (MAb), the binding of the scFvs was significantly different in that high level binding was evident on truncated forms of PrPc that reacted poorly or not at all with several pre-existing MAbs. These data suggest that the isolated scFv-Ps bind to novel epitopes within the aminocentral region of PrPc. In addition, the binding of MAbs to known linear epitopes within PrPc depends strongly on the endpoints of the target PrPc fragment used. (c) 2006 Elsevier Inc. All rights reserved.

Vibrational energy levels for the electronic ground state of the diazocarbene (CNN) molecule

The vibrational energy levels of diazocarbene (diazomethylene) in its electronic ground state, (X) over tilde (3) Sigma(-) CNN, have been predicted using the variational method. The potential energy surfaces of (X) over tilde (3) A" CNN were determined by employing ab initio single reference coupled cluster with single and double excitations (CCSD), CCSD with perturbative triple excitations [CCSD(T)], multi-reference complete active space self-consistent-field (CASSCF), and internally contracted multi-reference configuration interaction (ICMRCI) methods. The correlation-consistent polarised valence quadruple zeta (cc-pVQZ) basis set was used. Four sets of vibrational energy levels determined from the four distinct analytical potential functions have been compared with the experimental values from the laser-induced fluorescence measurements of Wurfel et al. obtained in 1992. The CCSD, CCSD(T), and CASSCF potentials have not provided satisfactory agreement with the experimental observations. In this light, the importance of both non-dynamic (static) and dynamic correlation effects in describing the ground state of CNN is emphasised. Our best theoretical fundamental frequencies at the cc-pVQZ ICMRCI level of theory, v(1) = 1230, v(2) = 394, and v(3) = 1420 cm(-1) are in excellent agreement with the experimental values of v(1) = 1235, v(2) = 396, and v(3) = 1419cm(-1) and the mean absolute deviation between the 23 calculated and experimental vibrational energy levels is only 7.4 cm(-1). It is shown that the previously suggested observation of the v(3) frequency at about 2847cm(-1) was in fact the first overtone 2v(3).

Recognition of sequence-information in synthetic copolymer chains by a conformationally-constrained tweezer molecule

A novel type of tweezer molecule containing electron-rich 2-pyrenyloxy arms has been designed to exploit intramolecular hydrogen bonding in stabilising a preferred conformation for supramolecular complexation to complementary sequences in aromatic copolyimides. This tweezer-conformation is demonstrated by single-crystal X-ray analyses of the tweezer molecule itself and of its complex with an aromatic diimide model-compound. In terms of its ability to bind selectively to polyimide chains, the new tweezer molecule shows very high sensitivity to sequence effects. Thus, even low concentrations of tweezer relative to diimide units (<2.5 mol%) are sufficient to produce dramatic, sequence-related splittings of the pyromellitimide proton NMR resonances. These induced resonance-shifts arise from ring-current shielding of pyromellitimide protons by the pyrenyloxy arms of the tweezer-molecule, and the magnitude of such shielding is a function of the tweezer-binding constant for any particular monomer sequence. Recognition of both short-range and long-range sequences is observed, the latter arising from cumulative ring-current shielding of diimide protons by tweezer molecules binding at multiple adjacent sites on the copolymer chain.

Supramolecular helix and beta-sheet through self-assembly of two isomeric tetrapeptides in crystals and formation of filaments and ribbons in the solid state

Single crystal X-ray diffraction studies show that the beta-turn structure of tetrapeptide I, Boc-Gly-Phe-Aib-Leu-OMe (Aib: alpha-amino isobutyric acid) self-assembles to a supramolecular helix through intermolecular hydrogen bonding along the crystallographic a axis. By contrast the beta-turn structure of an isomeric tetrapeptide II, Boc-Gly-Leu-Aib-Phe-OMe self-assembles to a supramolecular beta-sheet-like structure via a two-dimensional (a, b axis) intermolecular hydrogen bonding network and pi-pi interactions. FT-IR studies of the peptides revealed that both of them form intermolecularly hydrogen bonded supramolecular structures in the solid state. Field emission scanning electron micrographs (FE-SEM) of the dried fibrous materials of the peptides show different morphologies, non-twisted filaments in case of peptide I and non-twisted filaments and ribbon-like structures in case of peptide II.

The kinetics of the 2π+2π photodimerisation reactions of single-crystalline derivatives of trans-cinnamic acid: a study by infrared microspectroscopy

The kinetics of the photodimerisation reactions of the 2- and 4-β-halogeno-derivatives of trans-cinnamic acid (where the halogen is fluorine, chlorine or bromine) have been investigated by infrared microspectroscopy. It is found that none of the reactions proceed to 100% yield. This is in line with a reaction mechanism developed by Wernick and his co-workers that postulates the formation of isolated monomers within the solid, which cannot react. β-4-Bromo and β-4-chloro-trans-cinnamic acids show approximately first order kinetics, although in both cases the reaction accelerates somewhat as it proceeds. First order kinetics is explained in terms of a reaction between one excited- and one ground-state monomer molecule, while the acceleration of the reaction implies that it is promoted as defects are formed within the crystal. By contrast β-2-chloro-trans-cinnamic acid shows a strongly accelerating reaction which models closely to the contracting cube equation. β-2-Fluoro- and β-4-fluoro-trans-cinnamic acids show a close match to first order kinetics. The 4-fluoro-derivative, however, shows a reaction that proceeds via a structural intermediate. The difference in behaviour between the 2-fluoro- and 4-fluoro-derivative may be due to different C–HF hydrogen bonds observed within these single-crystalline starting materials.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Structure of adsorbed organometallic rhodium: model single atom catalysts

We have determined the structure of a complex rhodium carbonyl chloride [Rh(CO)(2)Cl] molecule adsorbed on the TiO2 (110) surface by the normal incidence x-ray standing wave technique. The data show that the technique is applicable to reducible oxide systems and that the dominant adsorbed species is undissociated with Rh binding atop bridging oxygen and to the Cl found close to the fivefold coordinated Ti ions in the surface. A minority geminal dicarboryl species, where Rh-Cl bond scission has occurred, is found bridging the bridging oxygen ions forming a high-symmetry site.

Effect of molecule branching and glycosidic linkage on the degradation of polydextrose by gut microbiota.

Polydextrose is a randomly linked complex glucose oligomer that is widely used as a sugar replacer, bulking agent, dietary fiber and prebiotic. Polydextrose is poorly utilized by the host and, during gastrointestinal transit, it is slowly degraded by intestinal microbes, although it is not known which parts of the complex molecule are preferred by the microbes. The microbial degradation of polydextrose was assessed by using a simulated model of colonic fermentation. The degradation products and their glycosidic linkages were measured by combined gas chromatography and mass spectrometry, and compared to those of intact polydextrose. Fermentation resulted in an increase in the relative abundance of non-branched molecules with a concomitant decrease in single-branched glucose molecules and a reduced total number of branching points. A detailed analysis showed a preponderance of 1,6 pyranose linkages. The results of this study demonstrate how intestinal microbes selectively degrade polydextrose, and provide an insight into the preferences of gut microbiota in the presence of different glycosidic linkages.

Crystal design approaches for the synthesis of paracetamol co-crystals

Crystal engineering principles were used to design three new co-crystals of paracetamol. A variety of potential cocrystal formers were initially identified from a search of the Cambridge Structural Database for molecules with complementary hydrogen-bond forming functionalities. Subsequent screening by powder X-ray diffraction of the products of the reaction of this library of molecules with paracetamol led to the discovery of new binary crystalline phases of paracetamol with trans-1,4- diaminocyclohexane (1); trans-1,4-di(4-pyridyl)ethylene (2); and 1,2-bis(4-pyridyl)ethane (3). The co-crystals were characterized by IR spectroscopy, differential scanning calorimetry, and 1H NMR spectroscopy. Single crystal X-ray structure analysis reveals that in all three co-crystals the co-crystal formers (CCF) are hydrogen bonded to the paracetamol molecules through O−H···N interactions. In co-crystals (1) and (2) the CCFs are interleaved between the chains of paracetamol molecules, while in co-crystal (3) there is an additional N−H···N hydrogen bond between the two components. A hierarchy of hydrogen bond formation is observed in which the best donor in the system, the phenolic O−H group of paracetamol, is preferentially hydrogen bonded to the best acceptor, the basic nitrogen atom of the co-crystal former. The geometric aspects of the hydrogen bonds in co-crystals 1−3 are discussed in terms of their electrostatic and charge-transfer components.

Investigating flavonoids as molecular templates for the design of small-molecule inhibitors of cell signaling

Epidemiological and clinical trials reveal compelling evidence for the ability of dietary flavonoids to lower cardiovascular disease risk. The mechanisms of action of these polyphenolic compounds are diverse, and of particular interest is their ability to function as protein and lipid kinase inhibitors. We have previously described structure-activity studies that reinforce the possibility for using flavonoid structures as templates for drug design. In the present study, we aim to begin constructing rational screening strategies for exploiting these compounds as templates for the design of clinically relevant, antiplatelet agents. We used the platelet as a model system to dissect the structural influence of flavonoids, stilbenes, anthocyanidins, and phenolic acids on inhibition of cell signaling and function. Functional groups identified as relevant for potent inhibition of platelet function included at least 2 benzene rings, a hydroxylated B ring, a planar C ring, a C ring ketone group, and a C-2 positioned B ring. Hydroxylation of the B ring with either a catechol group or a single C-4' hydroxyl may be required for efficient inhibition of collagen-stimulated tyrosine phosphorylated proteins of 125 to 130 kDa, but may not be necessary for that of phosphotyrosine proteins at approximately 29 kDa. The removal of the C ring C-3 hydroxyl together with a hydroxylated B ring (apigenin) may confer selectivity for 37 to 38 kDa phosphotyrosine proteins. We conclude that this study may form the basis for construction of maps of flavonoid inhibitory activity on kinase targets that may allow a multitargeted therapeutic approach with analogue counterparts and parent compounds.

Monitoring one-electron photo-oxidation of guanine in DNA crystals using ultrafast infrared spectroscopy

To understand the molecular origins of diseases caused by ultraviolet and visible light, and also to develop photodynamic therapy, it is important to resolve the mechanism of photoinduced DNA damage. Damage to DNA bound to a photosensitizer molecule frequently proceeds by one-electron photo-oxidation of guanine, but the precise dynamics of this process are sensitive to the location and the orientation of the photosensitizer, which are very difficult to define in solution. To overcome this, ultrafast time-resolved infrared (TRIR) spectroscopy was performed on photoexcited ruthenium polypyridyl–DNA crystals, the atomic structure of which was determined by X-ray crystallography. By combining the X-ray and TRIR data we are able to define both the geometry of the reaction site and the rates of individual steps in a reversible photoinduced electron-transfer process. This allows us to propose an individual guanine as the reaction site and, intriguingly, reveals that the dynamics in the crystal state are quite similar to those observed in the solvent medium.