Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Mechanistic insights into a gas–solid reaction in molecular crystals: the role of hydrogen bonding

Reactions in (molecular) organic crystalline solids have been shown to be important for exerting control that is unattainable over chemical transformations in solution. Such control has also been achieved for reactions within metal– organic cages. In these examples, the reactants are already in place within the crystals following the original crystal growth. The post-synthetic modification of metal–organic frameworks (MOFs and indeed reactions and catalysis within MOFs have been recently demonstrated; in these cases the reactants enter the crystals through permanent channels. Another growing area of interest within molecular solid-state chemistry is synthesis by mechanical co-grinding of solid reactants—often referred to as mechanochemistry. Finally, in a small number of reported examples, molecules also have been shown to enter nonporous crystals directly from the gas or vapor phase, but in only a few of these examples does a change in covalent bonding result, which indicates that a reaction occurs within the nonporous crystals. It is this latter type of highly uncommon reaction that is the focus of the present study.

Ice crystals growing from vapor in supercooled clouds between −2.5° and −22°C: testing current parameterization methods using laboratory data

The physical and empirical relationships used by microphysics schemes to control the rate at which vapor is transferred to ice crystals growing in supercooled clouds are compared with laboratory data to evaluate the realism of various model formulations. Ice crystal growth rates predicted from capacitance theory are compared with measurements from three independent laboratory studies. When the growth is diffusion- limited, the predicted growth rates are consistent with the measured values to within about 20% in 14 of the experiments analyzed, over the temperature range −2.5° to −22°C. Only two experiments showed significant disagreement with theory (growth rate overestimated by about 30%–40% at −3.7° and −10.6°C). Growth predictions using various ventilation factor parameterizations were also calculated and compared with supercooled wind tunnel data. It was found that neither of the standard parameterizations used for ventilation adequately described both needle and dendrite growth; however, by choosing habit-specific ventilation factors from previous numerical work it was possible to match the experimental data in both regimes. The relationships between crystal mass, capacitance, and fall velocity were investigated based on the laboratory data. It was found that for a given crystal size the capacitance was significantly overestimated by two of the microphysics schemes considered here, yet for a given crystal mass the growth rate was underestimated by those same schemes because of unrealistic mass/size assumptions. The fall speed for a given capacitance (controlling the residence time of a crystal in the supercooled layer relative to its effectiveness as a vapor sink, and the relative importance of ventilation effects) was found to be overpredicted by all the schemes in which fallout is permitted, implying that the modeled crystals reside for too short a time within the cloud layer and that the parameterized ventilation effect is too strong.

Evolution of network structure in polymer-stabilised liquid crystals

Experiments were performed to investigate the evolution of structure and morphology of the network in polymer-stabilised liquid crystals. In situ optical microscopy revealed that the morphology was significantly altered by extraction of the LC host, while scanning electron microscopy showed that the network morphology was also dependent on the polymerisation conditions and closely related to the depletion of monomer, as monitored by high performance liquid chromatography. Transmission electron microscopy allowed observation of internal structure, resolving microstructure on the order of 0. 1 μm.

A novel study of the polymerisation process involved in the formation of the network component of polymer-stabilised liquid crystals within electro-optic cells using high performance liquid chromatography

Polymer-stabilised liquid crystals are systems in which a small amount of monomer is dissolved within a liquid crystalline host, and then polymerised in situ to produce a network. The progress of the polymerisation, performed within electro-optic cells, was studied by establishing an analytical method novel to these systems. Samples were prepared by photopolymerisation of the monomer under well-defined reaction conditions; subsequent immersion in acetone caused the host and any unreacted monomer to dissolve. High performance liquid chromatography was used to separate and detect the various solutes in the resulting solutions, enabling the amount of unreacted monomer for a given set of conditions to be quantified. Longer irradiations cause a decrease in the proportion of unreacted monomer since more network is formed, while a more uniform LC director alignment (achieved by decreasing the sample thickness) or a higher level of order (achieved by decreasing the polymerisation temperature) promotes faster reactions.

Photo-induced phase transitions in azobenzene-doped liquid crystals

The effect of irradiation (UV-visible light) on a nematic liquid crystal doped with a photoactive azobenzene derivative was investigated. The selective irradiation results in either an E implies Z or Z implies E isomerization of the azobenzene unit. The effect of the isomerization is to cause a reversible depression of the liquid crystal to isotropic (LC implies l) phase transition temperature of the doped mixture, which can be monitored optically as an isothermal phase transition. This depression also results in a biphasic liquid crystal+isotropic region which is discussed. The authors investigate the cause and magnitude of the phase depression as a function of the amount of doped 4-butyl-4'-methoxyazobenzene (photoactive unit) in 4-cyano-4'-n-pentylbiphenyl (liquid crystal unit), and as a function of the percentage conversion of E implies Z (caused by isomerization) in the azobenzene. The photostationary state of the doped mixtures achieved by Z implies E isomerization is considered and its effect upon the transition temperature of the mixture and response time of the system is discussed. They discuss the implications of the photostationary state with regards to the reversibility of the photo-induced phase transition and hence potential applications.

The effect of the spacer length on the nature of coupling in side chain liquid crystals polymers and elastomers

Side chain liquid crystal polymers and elastomers exhibit a rich phase behaviour which arises from the antagonistic influences of the entropically disordered polymer chain configuration and the long range orientational ordering of the mesogenic units. This competition arises since the natural macroscopic phase separation is inhibited by the inherent chemical connectivity of the system. At the heart of this connectivity is the spacer link and we consider here its influence on the phase behaviour. In particular we consider a series of elastomers in which the number of alkyl units in the spacer is systematically varied from 2 to 6. The lengthening of the coupling spacer is accompanied by an alternation of the sign of coupling between the polymer chain and the mesogenic unit. These results demonstrate the dominating influence of the so-called hinge effect in determining the phase behaviour. In addition to the alternation of the sign there is some decrease in the magnitude of the coupling with increasing spacer length.

WAXS studies of global molecular orientation induced in nematic liquid crystals by simple shear flow

Global molecular orientation function coefficients for the nematic liquid crystal 4-cyano 4'-nn -pentylbiphenyl (5CB) in shear flow are presented, being extracted from 2-dimensional Wide-Angle X-ray Scattering data. A linear increase in orientation parameter P2 is observed with a logarithmic increase in shear rate. It is proposed that this arises from an increased number of LC directors aligning to the shear axis. Upon cessation of shear flow, the anisotropy is seen to relax away completely, over a time scale which is inversely proportional to the previously applied shear rate.

On spectral invariance of single scattering albedo for water droplets and ice crystals at weakly absorbing wavelengths

The single scattering albedo w_0l in atmospheric radiative transfer is the ratio of the scattering coefficient to the extinction coefficient. For cloud water droplets both the scattering and absorption coefficients, thus the single scattering albedo, are functions of wavelength l and droplet size r. This note shows that for water droplets at weakly absorbing wavelengths, the ratio w_0l(r)/w_0l(r0) of two single scattering albedo spectra is a linear function of w_0l(r). The slope and intercept of the linear function are wavelength independent and sum to unity. This relationship allows for a representation of any single scattering albedo spectrum w_0l(r) via one known spectrum w_0l(r0). We provide a simple physical explanation of the discovered relationship. Similar linear relationships were found for the single scattering albedo spectra of non-spherical ice crystals.

Crystal design approaches for the synthesis of paracetamol co-crystals

Crystal engineering principles were used to design three new co-crystals of paracetamol. A variety of potential cocrystal formers were initially identified from a search of the Cambridge Structural Database for molecules with complementary hydrogen-bond forming functionalities. Subsequent screening by powder X-ray diffraction of the products of the reaction of this library of molecules with paracetamol led to the discovery of new binary crystalline phases of paracetamol with trans-1,4- diaminocyclohexane (1); trans-1,4-di(4-pyridyl)ethylene (2); and 1,2-bis(4-pyridyl)ethane (3). The co-crystals were characterized by IR spectroscopy, differential scanning calorimetry, and 1H NMR spectroscopy. Single crystal X-ray structure analysis reveals that in all three co-crystals the co-crystal formers (CCF) are hydrogen bonded to the paracetamol molecules through O−H···N interactions. In co-crystals (1) and (2) the CCFs are interleaved between the chains of paracetamol molecules, while in co-crystal (3) there is an additional N−H···N hydrogen bond between the two components. A hierarchy of hydrogen bond formation is observed in which the best donor in the system, the phenolic O−H group of paracetamol, is preferentially hydrogen bonded to the best acceptor, the basic nitrogen atom of the co-crystal former. The geometric aspects of the hydrogen bonds in co-crystals 1−3 are discussed in terms of their electrostatic and charge-transfer components.

Substitutional and orientational disorder in organic crystals: a symmetry-adapted ensemble model

Modelling of disorder in organic crystals is highly desirable since it would allow thermodynamic stabilities and other disorder-sensitive properties to be estimated for such systems. Two disordered organic molecular systems are modeled using a symmetry-adapted ensemble approach, in which the disordered system is treated as an ensemble of the configurations of a supercell with respect to substitution of one disorder component for another. Computation time is kept manageable by performing calculations only on the symmetrically inequivalent configurations. Calculations are presented on a substitutionally disordered system, the dichloro/dibromobenzene solid solution, and on an orientationally disordered system, eniluracil, and the resultant free energies, disorder patterns, and system properties are discussed. The results are found to be in agreement with experiment following manual removal of physically implausible configurations from ensemble averages, highlighting the dangers of a completely automated approach to organic crystal thermodynamics which ignores the barriers to equilibration once the crystal has been formed.

A robust two-dimensional hydrogen-bonded network for the predictable assembly of ternary co-crystals of furosemide

Consideration of the geometrical features of the functional groups present in furosemide has enabled synthesis of a series of ternary co-crystals with predictable structural features, containing a robust asymmetric two-dimensional network.

Rayleigh scattering by hexagonal ice crystals and the interpretation of dual-polarisation radar measurements

Dual-polarisation radar measurements provide valuable information about the shapes and orientations of atmospheric ice particles. For quantitative interpretation of these data in the Rayleigh regime, common practice is to approximate the true ice crystal shape with that of a spheroid. Calculations using the discrete dipole approximation for a wide range of crystal aspect ratios demonstrate that approximating hexagonal plates as spheroids leads to significant errors in the predicted differential reflectivity, by as much as 1.5 dB. An empirical modification of the shape factors in Gans's spheroid theory was made using the numerical data. The resulting simple expressions, like Gans's theory, can be applied to crystals in any desired orientation, illuminated by an arbitrarily polarised wave, but are much more accurate for hexagonal particles. Calculations of the scattering from more complex branched and dendritic crystals indicate that these may be accurately modelled using the new expression, but with a reduced permittivity dependent on the volume of ice relative to an enclosing hexagonal prism.

Monitoring one-electron photo-oxidation of guanine in DNA crystals using ultrafast infrared spectroscopy

To understand the molecular origins of diseases caused by ultraviolet and visible light, and also to develop photodynamic therapy, it is important to resolve the mechanism of photoinduced DNA damage. Damage to DNA bound to a photosensitizer molecule frequently proceeds by one-electron photo-oxidation of guanine, but the precise dynamics of this process are sensitive to the location and the orientation of the photosensitizer, which are very difficult to define in solution. To overcome this, ultrafast time-resolved infrared (TRIR) spectroscopy was performed on photoexcited ruthenium polypyridyl–DNA crystals, the atomic structure of which was determined by X-ray crystallography. By combining the X-ray and TRIR data we are able to define both the geometry of the reaction site and the rates of individual steps in a reversible photoinduced electron-transfer process. This allows us to propose an individual guanine as the reaction site and, intriguingly, reveals that the dynamics in the crystal state are quite similar to those observed in the solvent medium.