41 resultados para International Union of Mine, Mill and Smelter Workers


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The First International Workshop on The Role and Impact of Mathematics in Medicine (RIMM) convened in Paris in June 2010. A broad range of researchers discussed the difficulties, challenges and opportunities faced by those wishing to see mathematical methods contribute to improved medical outcomes. Finding mechanisms for inter- disciplinary meetings, developing a common language, staying focused on the medical problem at hand, deriving realistic mathematical solutions, obtaining

Relevância:

100.00% 100.00%

Publicador:

Resumo:

As the mean age of the global population increases, breast cancer in older individuals will be increasingly encountered in clinical practice. Management decisions should not be based on age alone. Establishing recommendations for management of older individuals with breast cancer is challenging because of very limited level 1 evidence in this heterogeneous population. In 2007, the International Society of Geriatric Oncology (SIOG) created a task force to provide evidence-based recommendations for the management of breast cancer in elderly individuals. In 2010, a multidisciplinary SIOG and European Society of Breast Cancer Specialists (EUSOMA) task force gathered to expand and update the 2007 recommendations. The recommendations were expanded to include geriatric assessment, competing causes of mortality, ductal carcinoma in situ, drug safety and compliance, patient preferences, barriers to treatment, and male breast cancer. Recommendations were updated for screening, primary endocrine therapy, surgery, radiotherapy, neoadjuvant and adjuvant systemic therapy, and metastatic breast cancer.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The paper explores the relationships between UK commercial real estate and regional economic development as a foundation for the analysis of the role of real estate investment in local economic development. Linkages between economic growth, development, real estate performance and investment allocations are documented. Long-run regional property performance is not the product of long-run economic growth, and weakly related to indicators of long-run supply and demand. Changes in regional portfolio weights seem driven by neither market performance nor underlying fundamentals. In the short run, regional investment shifts show no clear leads or lags with market performance.