72 resultados para INSTRUMENTATION
Resumo:
Discrepancies between recent global earth albedo anomaly data obtained from the climate models, space and ground observations call for a new and better earth reflectance measurement technique. The SALEX (Space Ashen Light Explorer) instrument is a space-based visible and IR instrument for precise estimation of the global earth albedo by measuring the ashen light reflected off the shadowy side of the Moon from the low earth orbit. The instrument consists of a conventional 2-mirror telescope, a pair of a 3-mirror visible imager and an IR bolometer. The performance of this unique multi-channel optical system is sensitive to the stray light contamination due to the complex optical train incorporating several reflecting and refracting elements, associated mounts and the payload mechanical enclosure. This could be further aggravated by the very bright and extended observation target (i.e. the Moon). In this paper, we report the details of extensive stray light analysis including ghosts and cross-talks, leading to the optimum set of stray light precautions for the highest signal-to-noise ratio attainable.
Resumo:
This conference, held 14-18 September 1981, addressed many aspects of high resolution molecular spectroscopy. Measurement techniques for remotely identifying trace gases in the atmosphere were discussed. Instrumentation for highly accurate and precise measurement of molecular emissions were described. The objective of the colloquium was to bring together molecular spectroscopists working in different regions of the electromagnetic spectrum from the ultraviolet to radio frequencies. These scientists shared a common interest in high resolution gas phase spectra and their analyses. The objective was met through the presentation of about 20 invited papers and many more contributed papers.
Resumo:
Cercal hairs represent in cricket a wind sensitive escape system, able to detect the airflow generated from predating species. These sensors have been studied as a biomimetic concept to allow the development of MEMS for biomedical use. In particular, the behaviour of the hairs, including airflow response, resonant frequency and damping, has been investigated up to a frequency of 20 kHz. The microscopic nature of the hairs, the complex vibrations of excited hairs and the high damping of the system suggested that the use of Laser Doppler vibrometry could possibly improve the test performance. Two types of tests were performed: in the first case the hairs were indirectly excited using the signal obtained from a vibrating aluminium plate, whilst in the second case the hairs were directly excited using a white noise chirp. The results from the first experiment indicated that the hairs move in-phase with the exciting signal up to frequencies in the order of 10 kHz, responding to the vibration modes of the plate with a signal attenuation of 12 to 20 dB. The chirp experiment revealed the presence of rotational resonant modes at 6850 and 11300 Hz. No clear effect of hair length was perceivable on the vibration response of the filiform sensors. The obtained results proved promising to support the mechanical and vibration characterisation of the hairs and suggest that scanning Laser vibrometry can be used extensively on highly dampened biological materials.
Resumo:
This paper provides an introduction to Wireless Sensor Networks (WSN), their applications in the field of control engineering and elsewhere and gives pointers to future research needs. WSN are collections of stand-alone devices which, typically, have one or more sensors (e.g. temperature, light level), some limited processing capability and a wireless interface allowing communication with a base station. As they are usually battery powered, the biggest challenge is to achieve the necessary monitoring whilst using the least amount of power.
Resumo:
The VISIR instrument for the European Southern Observatory (ESO) Very Large Telescope (VLT) is a thermal-infrared imager and spectrometer currently being developed by the French Service d'Astrophysique of CEA Saclay, and Dutch NFRA ASTRON Dwingeloo consortium. This cryogenic instrument will employ precision infrared bandpass filters in the N-( =7.5-14µm) and Q-( =16-28µm) band mid-IR atmospheric windows to study interstellar and circumstellar environments crucial for star and planetary formation theories. As the filters in these mid-IR wavelength ranges are of interest to many astronomical cryogenic instruments, a worldwide astronomical filter consortium was set up with participation from 12 differing institutes, each requiring instrument specific filter operating environments and optical metrology. This paper describes the design and fabrication methods used to manufacture these astronomical consortium filters, including the rationale for the selection of multilayer coating designs, temperature-dependant optical properties of the filter materials and FTIR spectral measurements showing the changes in passband and blocking performance on cooling to <50K. We also describe the development of a 7-14µm broadband antireflection coating deposited on Ge lenses and KRS-5 grisms for cryogenic operation at 40K
Resumo:
The health risks associated with the inhalation or ingestion of cadmium are well documented([1,2]). During the past 18 years, EU legislation has steadily been introduced to restrict its use, leaving a requirement for the development of replacement materials. This paper looks at possible alternatives to various cadmium II-VI dielectric compounds used in the deposition of optical thin-films for various opto-electronic devices. Application areas of particular interest are for infrared multilayer interference filter fabrication and solar cell industries, where cadmium-based coatings currently find widespread use. The results of single and multilayer designs comprising CdTe, CdS, CdSe and PbTe deposited onto group IV and II-VI materials as interference filters for the mid-IR region are presented. Thin films of SnN, SnO2, SnS and SnSe are fabricated by plasma assisted CVD, reactive RF sputtering and thermal evaporation. Examination of these films using FTIR spectroscopy, SEM, EDX analysis and optical characterisation methods provide details of material dispersion, absorption, composition, refractive index, energy band gap and layer thicknesses. The optimisation of deposition parameters in order to synthesise coatings with similar optical and semiconductor properties as those containing cadmium has been investigated. Results of environmental, durability and stability trials are also presented.
Resumo:
This paper presents an improved parallel Two-Pass Hexagonal (TPA) algorithm constituted by Linear Hashtable Motion Estimation Algorithm (LHMEA) and Hexagonal Search (HEXBS) for motion estimation. Motion Vectors (MV) are generated from the first-pass LHMEA and used as predictors for second-pass HEXBS motion estimation, which only searches a small number of Macroblocks (MBs). We used bashtable into video processing and completed parallel implementation. The hashtable structure of LHMEA is improved compared to the original TPA and LHMEA. We propose and evaluate parallel implementations of the LHMEA of TPA on clusters of workstations for real time video compression. The implementation contains spatial and temporal approaches. The performance of the algorithm is evaluated by using standard video sequences and the results are compared to current algorithms.
Resumo:
In this article, we provide an initial insight into the study of MI and what it means for a machine to be intelligent. We discuss how MI has progressed to date and consider future scenarios in a realistic and logical way as much as possible. To do this, we unravel one of the major stumbling blocks to the study of MI, which is the field that has become widely known as "artificial intelligence"
Resumo:
Letter to the editor relates to article Warwick, K. and Nasuto, S.J (2006). 'Historical and Current Machine Intelligence.' IEEE Instrumentation and Measurement Magazine 9 (6):20-26.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
The ability of four operational weather forecast models [ECMWF, Action de Recherche Petite Echelle Grande Echelle model (ARPEGE), Regional Atmospheric Climate Model (RACMO), and Met Office] to generate a cloud at the right location and time (the cloud frequency of occurrence) is assessed in the present paper using a two-year time series of observations collected by profiling ground-based active remote sensors (cloud radar and lidar) located at three different sites in western Europe (Cabauw. Netherlands; Chilbolton, United Kingdom; and Palaiseau, France). Particular attention is given to potential biases that may arise from instrumentation differences (especially sensitivity) from one site to another and intermittent sampling. In a second step the statistical properties of the cloud variables involved in most advanced cloud schemes of numerical weather forecast models (ice water content and cloud fraction) are characterized and compared with their counterparts in the models. The two years of observations are first considered as a whole in order to evaluate the accuracy of the statistical representation of the cloud variables in each model. It is shown that all models tend to produce too many high-level clouds, with too-high cloud fraction and ice water content. The midlevel and low-level cloud occurrence is also generally overestimated, with too-low cloud fraction but a correct ice water content. The dataset is then divided into seasons to evaluate the potential of the models to generate different cloud situations in response to different large-scale forcings. Strong variations in cloud occurrence are found in the observations from one season to the same season the following year as well as in the seasonal cycle. Overall, the model biases observed using the whole dataset are still found at seasonal scale, but the models generally manage to well reproduce the observed seasonal variations in cloud occurrence. Overall, models do not generate the same cloud fraction distributions and these distributions do not agree with the observations. Another general conclusion is that the use of continuous ground-based radar and lidar observations is definitely a powerful tool for evaluating model cloud schemes and for a responsive assessment of the benefit achieved by changing or tuning a model cloud
Resumo:
An updated analysis of observed stratospheric temperature variability and trends is presented on the basis of satellite, radiosonde, and lidar observations. Satellite data include measurements from the series of NOAA operational instruments, including the Microwave Sounding Unit covering 1979–2007 and the Stratospheric Sounding Unit (SSU) covering 1979–2005. Radiosonde results are compared for six different data sets, incorporating a variety of homogeneity adjustments to account for changes in instrumentation and observational practices. Temperature changes in the lower stratosphere show cooling of 0.5 K/decade over much of the globe for 1979–2007, with some differences in detail among the different radiosonde and satellite data sets. Substantially larger cooling trends are observed in the Antarctic lower stratosphere during spring and summer, in association with development of the Antarctic ozone hole. Trends in the lower stratosphere derived from radiosonde data are also analyzed for a longer record (back to 1958); trends for the presatellite era (1958–1978) have a large range among the different homogenized data sets, implying large trend uncertainties. Trends in the middle and upper stratosphere have been derived from updated SSU data, taking into account changes in the SSU weighting functions due to observed atmospheric CO2 increases. The results show mean cooling of 0.5–1.5 K/decade during 1979–2005, with the greatest cooling in the upper stratosphere near 40–50 km. Temperature anomalies throughout the stratosphere were relatively constant during the decade 1995–2005. Long records of lidar temperature measurements at a few locations show reasonable agreement with SSU trends, although sampling uncertainties are large in the localized lidar measurements. Updated estimates of the solar cycle influence on stratospheric temperatures show a statistically significant signal in the tropics (30N–S), with an amplitude (solar maximum minus solar minimum) of 0.5 K (lower stratosphere) to 1.0 K (upper stratosphere).