88 resultados para Hubbard, Phil
Resumo:
Epidemiological data suggest that those who consume a diet rich in quercetin-containing foods may have a reduced risk of CVD. Furthermore, in vitro and ex vivo studies have observed the inhibition of collagen-induced platelet activation by quercetin. The aim of the present study was to investigate the possible inhibitory effects of quercetin ingestion from a dietary source on collagen-stimulated platelet aggregation and signalling. A double-blind randomised cross-over pilot study was undertaken. Subjects ingested a soup containing either a high or a low amount of quercetin. Plasma quercetin concentrations and platelet aggregation and signalling were assessed after soup ingestion. The high-quercetin soup contained 69 mg total quercetin compared with the low-quercetin soup containing 5 mg total quercetin. Plasma quercetin concentrations were significantly higher after high-quercetin soup ingestion than after low-quercetin soup ingestion and peaked at 2.59 (SEM 0.42) mu mol/l. Collagen-stimulated (0.5 mu g/ml) platelet aggregation was inhibited after ingestion of the high-quercetin soup in a time-dependent manner. Collagen-stimulated tyrosine phosphorylation of a key component of the collagen-signalling pathway via glycoprotein VI, Syk, was significantly inhibited by ingestion of the high-quercetin soup. The inhibition of Syk tyrosine phosphorylation was correlated with the area under the curve for the high-quercetin plasma profile. In conclusion, the ingestion of quercetin from a dietary source of onion soup could inhibit some aspects of collagen-stimulated platelet aggregation and signalling ex vivo. This further substantiates the epidemiological data suggesting that those who preferentially consume high amounts of quercetin-containing foods have a reduced risk of thrombosis and potential CVD risk.
Resumo:
Formation and rearrangement of disulfide bonds during the correct folding of nascent proteins is modulated by a family of enzymes known as thiol isomerases, which include protein disulfide isomerase (PDI), endoplasmic reticulum protein 5 (ERP5), and ERP57. Recent evidence supports an alternative role for this family of proteins on the surface of cells, where they are involved in receptor 'remodeling and recognition. In platelets, blocking PDI with inhibitory antibodies inhibits a number of platelet activation pathways, including aggregation, secretion, and fibrinogen binding. Analysis of human platelet membrane fractions identified the presence of the thiol isomerase protein ERP5. Further study showed that ERP5 is resident mainly on platelet intracellular membranes, although it is rapidly recruited to the cell, surface in response to a range of platelet agonists. Blocking cell-surface ERP5 using inhibitory antibodies leads to a decrease in platelet aggregation in response to agonists, and a decrease in fibrinogen binding and P-selectin exposure. It is Possible that this is based on the disruption of integrin function, as we observed that ERP5 becomes physically associated with the integrin beta(3) subunit during platelet stimulation. These results provide new insights into the involvement of thiol isomerases and regulation of platelet activation. (C) 2005 by The American Society of Hematology.
Resumo:
There has been much recent interest in the cardiovascular benefits of dietary isoflavones. The aim of the present in vitro studies was to investigate potential anti-thrombogenic and anti-atherogenic effects of the isoflavones genistein and daidzein in platelets, macrophages and endothelial cells. Pre-treatment with either isoflavone inhibited collagen-induced platelet aggregation in a dose-dependent manner. In a macrophage cell line (RAW 264-7) activated with interferon gamma plus lipopolysaccharide, both isoflavones were found to inhibit NO production and tumour necrosis factor alpha (TNF-alpha) secretion dose-dependently, but they did not affect mRNA levels for inducible nitric oxide synthase and cyclo-oxygenase-2. Both isoflavones also dose-dependently decreased monocyte chemoattractant protein-1 secretion induced by TNF-alpha in human umbilical vein endothelial cells. Compared with daidzein, genistein exerted greater inhibitory effects for all parameters studied. The present data contributes to our knowledge on the molecular mechanisms by which isoflavones may protect against coronary artery disease. Further studies are required to determine whether the effects of isoflavones observed in the current in vitro studies are relevant to the aetiology of coronary artery disease in vivo.
Resumo:
Platelets play a substantial role in cardiovascular disease, and for many years there has been a search for dietary components that are able to inhibit platelet function and therefore decrease the risk of cardiovascular disease. Platelets can be inhibited by alcohol, dietary fats and some antioxidants, including a group of compounds, the polyphenols, found in fruits and vegetables. A number of these compounds have been shown to inhibit platelet function both in vitro and in vivo. In the present study the effects of the hydroxycinnamates and the flavonoid quercetin on platelet activation and cell signalling in vitro were investigated. The hydroxycinnamates inhibited platelet function, although not at levels that can be achieved in human plasma by dietary intervention. However, quercetin inhibited platelet aggregation at levels lower than those previously reported. Quercetin was also found to inhibit intracellular Ca mobilisation and whole-cell tyrosine protein phosphorylation in platelets, which are both processes essential for platelet activation. The effect of polyphenols on platelet aggregation in vivo was also investigated. Twenty subjects followed a low-polyphenol diet for 3 d before and also during supplementation. All subjects were supplemented with a polyphenol-rich meal every lunchtime for 5 d. Platelet aggregation and plasma flavonols were measured at baseline and after 5 d of dietary supplementation. Total plasma flavonoids increased significantly after the dietary intervention period (P = 0.001). However, no significant changes in ex vivo platelet aggregation were observed. Further investigation of the effects of individual polyphenolic compounds on platelet function, both in vitro and in vivo, is required in order to elucidate their role in the relationship between diet and the risk of cardiovascular disease.
Resumo:
Background: Quercetin, a flavonoid present in the human diet, which is found in high levels in onions, apples, tea and wine, has been shown previously to inhibit platelet aggregation and signaling in vitro. Consequently, it has been proposed that quercetin may contribute to the protective effects against cardiovascular disease of a diet rich in fruit and vegetables. Objectives: A pilot human dietary intervention study was designed to investigate the relationship between the ingestion of dietary quercetin and platelet function. Methods: Human subjects ingested either 150 mg or 300 mg quercetin-4'-O-beta-D-glucoside Supplement to determine the systemic availability of quercetin. Platelets were isolated from subjects to analyse collagen-stimulated cell signaling and aggregation. Results: Plasma quercetin concentrations peaked at 4.66 mum (+/-0.77) and 9.72mum (+/-1.38) 30min after ingestion of 150-mg and 300-mg doses of quercefin-4'-O-beta-D-glucoside, respectively, demonstrating that quercetin was bioavailable, with plasma concentrations attained in the range known to affect platelet function in vitro. Platelet aggregation was inhibited 30 and 120 min after ingestion of both doses of quercetin-4'-O-beta-D-glucoside. Correspondingly, collagen-stimulated tyrosine phosphorylation of total platelet proteins was inhibited. This was accorripanied by reduced tyrosine phosphorylation of the tyrosine kinase Syk and phospholipase Cgamma2, components of the platelet glycoprotein VI collagen receptor signaling pathway. Conclusions: This study provides new evidence of the relatively high systemic availability of quercetin in the form of quercetin-4'-O-beta-D-glucoside by supplementation, and implicates quercetin as a dietary inhibitor of platelet cell signaling and thrombus formation.
Resumo:
Background: The regulation of platelet function by pharmacological agents that modulate platelet signaling haspharmacolo proven a successful approach to the prevention of thrombosis. A variety of molecules present in the diet have been shown to inhibit platelet activation, including the antioxidant quercetin. Objectives: In this report we investigate the molecular mechanisms through which quercetin inhibits collagen-stimulated platelet aggregation. Methods: The effect of quercetin on platelet aggregation, intracellular calcium release, whole cell tyrosine phosphorylation and intracellular signaling events including tyrosine phosphorylation and kinase activity of proteins involved in the collagen-stimulated glycoprotein (GP) signaling pathway were investigated. Results: We report that quercetin inhibits collagen-stimulated whole cell protein tyrosine phosphorylation and intracellular mobilization of calcium, in a concentration-dependent manner. Quercetin was also found to inhibit various events in signaling generated by the collagen receptor GPVI. This includes collagen-stimulated tyrosine phosphorylation of the Fc receptor gamma-chain, Syk, LAT and phospholipase Cgamma2. Inhibition of phosphorylation of the Fc receptor gamma-chain suggests that quercetin inhibits early signaling events following stimulation of platelets with collagen. The activity of the kinases that phosphorylate the Fc receptor gamma-chain, Fyn and Lyn, as well as the tyrosine kinase Syk and phosphoinositide 3-kinase was also inhibited by quercetin in a concentration-dependent manner, both in whole cells and in isolation. Conclusions: The present results provide a molecular basis for the inhibition by quercetin of collagen-stimulated platelet activation, through inhibition of multiple components of the GPVI signaling pathway, and may begin to explain the proposed health benefits of high quercetin intake.
Resumo:
There has been much recent interest in the cardiovascular benefits of dietary isoflavones. The aim of the present in vitro studies was to investigate potential anti-thrombogenic and anti-atherogenic effects of the isoflavones genistein and daidzein in platelets, macrophages and endothelial cells. Pre-treatment with either isoflavone inhibited collagen-induced platelet aggregation in a dose-dependent manner. In a macrophage cell line (RAW 264-7) activated with interferon gamma plus lipopolysaccharide, both isoflavones were found to inhibit NO production and tumour necrosis factor alpha (TNF-alpha) secretion dose-dependently, but they did not affect mRNA levels for inducible nitric oxide synthase and cyclo-oxygenase-2. Both isoflavones also dose-dependently decreased monocyte chemoattractant protein-1 secretion induced by TNF-alpha in human umbilical vein endothelial cells. Compared with daidzein, genistein exerted greater inhibitory effects for all parameters studied. The present data contributes to our knowledge on the molecular mechanisms by which isoflavones may protect against coronary artery disease. Further studies are required to determine whether the effects of isoflavones observed in the current in vitro studies are relevant to the aetiology of coronary artery disease in vivo.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
The rutile TiO2(110) surface has been doped with sub-monolayer metallic Cr, which oxidises and donates charge to specific surface Ti ions. X-Ray and ultra violet photoemission spectroscopy and first principles density functional theory with Hubbard U are used to assign the oxidation states of Cr and surface Ti and we find that Cr2+ forms on bridging oxygen ions and a 5-fold coordinated surface Ti atom is reduced to Ti3+ and the Cr ions readily react with oxygen (to Cr3+), which leads to depletion of surface Ti3+ 3d electrons.
Resumo:
Cross-contamination between cell lines is a longstanding and frequent cause of scientific misrepresentation. Estimates from national testing services indicate that up to 36% of cell lines are of a different origin or species to that claimed. To test a standard method of cell line authentication, 253 human cell lines from banks and research institutes worldwide were analyzed by short tandem repeat profiling. The short tandem repeat profile is a simple numerical code that is reproducible between laboratories, is inexpensive, and can provide an international reference standard for every cell line. If DNA profiling of cell lines is accepted and demanded internationally, scientific misrepresentation because of cross-contamination can be largely eliminated.
Resumo:
A distributed Lagrangian moving-mesh finite element method is applied to problems involving changes of phase. The algorithm uses a distributed conservation principle to determine nodal mesh velocities, which are then used to move the nodes. The nodal values are obtained from an ALE (Arbitrary Lagrangian-Eulerian) equation, which represents a generalization of the original algorithm presented in Applied Numerical Mathematics, 54:450--469 (2005). Having described the details of the generalized algorithm it is validated on two test cases from the original paper and is then applied to one-phase and, for the first time, two-phase Stefan problems in one and two space dimensions, paying particular attention to the implementation of the interface boundary conditions. Results are presented to demonstrate the accuracy and the effectiveness of the method, including comparisons against analytical solutions where available.
Resumo:
Higher animal welfare standards increase costs along the supply chain of certified animal-friendly products (AFP). Since the market outcome of certified AFP depends on consumer confidence toward supply chain operators complying with these standards, the role of trust in consumer willingness-to-pay (WTP) for AFP is paramount. Results from a contingent valuation survey administered in five European Union countries show that WTP estimates were sensitive to robust measures of consumer trust for certified AFP. Deriving the WTP effect of a single food category on total food expenditure is difficult for survey respondents; hence, a budget approach was employed to facilitate this process.