19 resultados para GAAS SINGLE-CRYSTALS
Resumo:
Single crystal X-ray diffraction studies show that the beta-turn structure of tetrapeptide I, Boc-Gly-Phe-Aib-Leu-OMe (Aib: alpha-amino isobutyric acid) self-assembles to a supramolecular helix through intermolecular hydrogen bonding along the crystallographic a axis. By contrast the beta-turn structure of an isomeric tetrapeptide II, Boc-Gly-Leu-Aib-Phe-OMe self-assembles to a supramolecular beta-sheet-like structure via a two-dimensional (a, b axis) intermolecular hydrogen bonding network and pi-pi interactions. FT-IR studies of the peptides revealed that both of them form intermolecularly hydrogen bonded supramolecular structures in the solid state. Field emission scanning electron micrographs (FE-SEM) of the dried fibrous materials of the peptides show different morphologies, non-twisted filaments in case of peptide I and non-twisted filaments and ribbon-like structures in case of peptide II.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
Crystal engineering principles were used to design three new co-crystals of paracetamol. A variety of potential cocrystal formers were initially identified from a search of the Cambridge Structural Database for molecules with complementary hydrogen-bond forming functionalities. Subsequent screening by powder X-ray diffraction of the products of the reaction of this library of molecules with paracetamol led to the discovery of new binary crystalline phases of paracetamol with trans-1,4- diaminocyclohexane (1); trans-1,4-di(4-pyridyl)ethylene (2); and 1,2-bis(4-pyridyl)ethane (3). The co-crystals were characterized by IR spectroscopy, differential scanning calorimetry, and 1H NMR spectroscopy. Single crystal X-ray structure analysis reveals that in all three co-crystals the co-crystal formers (CCF) are hydrogen bonded to the paracetamol molecules through O−H···N interactions. In co-crystals (1) and (2) the CCFs are interleaved between the chains of paracetamol molecules, while in co-crystal (3) there is an additional N−H···N hydrogen bond between the two components. A hierarchy of hydrogen bond formation is observed in which the best donor in the system, the phenolic O−H group of paracetamol, is preferentially hydrogen bonded to the best acceptor, the basic nitrogen atom of the co-crystal former. The geometric aspects of the hydrogen bonds in co-crystals 1−3 are discussed in terms of their electrostatic and charge-transfer components.
Resumo:
A single habit parameterization for the shortwave optical properties of cirrus is presented. The parameterization utilizes a hollow particle geometry, with stepped internal cavities as identified in laboratory and field studies. This particular habit was chosen as both experimental and theoretical results show that the particle exhibits lower asymmetry parameters when compared to solid crystals of the same aspect ratio. The aspect ratio of the particle was varied as a function of maximum dimension, D, in order to adhere to the same physical relationships assumed in the microphysical scheme in a configuration of the Met Office atmosphere-only global model, concerning particle mass, size and effective density. Single scattering properties were then computed using T-Matrix, Ray Tracing with Diffraction on Facets (RTDF) and Ray Tracing (RT) for small, medium, and large size parameters respectively. The scattering properties were integrated over 28 particle size distributions as used in the microphysical scheme. The fits were then parameterized as simple functions of Ice Water Content (IWC) for 6 shortwave bands. The parameterization was implemented into the GA6 configuration of the Met Office Unified Model along with the current operational long-wave parameterization. The GA6 configuration is used to simulate the annual twenty-year short-wave (SW) fluxes at top-of-atmosphere (TOA) and also the temperature and humidity structure of the atmosphere. The parameterization presented here is compared against the current operational model and a more recent habit mixture model.