63 resultados para Directed Union of Artinian Subrings


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The title solvate, C7H8N4O2 center dot C2H6OS, was obtained unintentionally from a cocrystal screen involving theophylline and isophthalic acid. One molecule each of theophylline and dimethyl sulfoxide is present in the asymmetric unit. The packing consists of molecular sheets lying parallel to the ( 040) series of lattice planes, in which each theophylline molecule is hydrogen bonded to one dimethyl sulfoxide molecule through an N-H center dot center dot center dot O [2.7658 (15) angstrom] hydrogen bond. This particular hydrogen-bond donor was found to be used in this type of interaction in a variety of other crystal structures of theophylline.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Rolling Contact Fatigue (RCF) is one of the main issues that concern, at least initially, the head of the railway; progressively they can be of very high importance as they can propagate inside the material with the risk of damaging the railway. In this work, two different non-destructive techniques, infrared thermography (IRT) and fibre optics microscopy (FOM), were used in the inspection of railways for the tracing of defects and deterioration signs. In the first instance, two different approaches (dynamic and pulsed thermography) were used, whilst in the case of FOM, microscopic characterisation of the railway heads and classification of the deterioration -- damage on the railways according to the UIC (International Union of Railways) code, took place. Results from both techniques are presented and discussed.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A hitherto undescribed Actinomyces-like bacterium was isolated from the vagina of a dog. Biochemical testing and PAGE analysis of whole-cell proteins indicated that the isolate was phenotypically different from previously described Actinomyces species and related taxa. Sequencing of 165 rRNA showed that the unknown bacterium was distinct from all currently known Actinomyces species. Phylogenetically, the unidentified organism displayed a specific association with Actinomyces europaeus, but a sequence divergence of > 5% demonstrated that it represents a distinct species. Based on both phenotypic and 165 rRNA sequence considerations, it is proposed that the unknown strain from a dog be classified as a novel species, Actinomyces coleocanis sp. nov. The type strain is CCUG 41708T (= CIP 106873T).

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A polyphasic taxonomic study was performed on a previously unidentified gram-positive, facultatively anaerobic, diphtheroid-shaped organism isolated from a vaginal discharge of a horse. Comparative 16S rRNA gene sequencing demonstrated that the strain was a member of the genus Arcanobacterium, but sequence divergence values of >4% with described species of this genus (viz: Arcanobacterium haemolyticum, Arcanobacterium bernardiae, Arcanobacterium phocae, Arcanobacterium pluranimalium and Arcanobacterium pyogenes) demonstrated that the isolate represented a novel species. The unknown bacterium was readily distinguished from other Arcanobacterium species by biochemical tests. Based on phylogenetic and phenotypic evidence, it is proposed that the unknown bacterium be classified as Arcanobacterium hippocoleae sp. nov. The type strain of A. hippocoleae is CCUG 44697T (= CIP 106850T).

Relevância:

100.00% 100.00%

Publicador:

Resumo:

YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

In its three recent rulings in the cases of Zambrano, McCarthy, and Dereci, the Court appears to have been determined to redefine the external boundaries of EU law, in cases involving the family reunification rights of Union citizens.These three judgments can be read as an indication that for Article 20 TFEU to apply, there is no longer a requirement of a cross-border element on the facts of the case, and that it is sufficient if the contested national measure has the effect of ‘depriving citizens of the Union of the genuine enjoyment of the substance’ of their rights (the ‘Zambrano principle’).The cases can, at the same time, also be read as a confirmation that the free movement provisions do – still – require a cross-border element and, in particular, the exercise of inter-State movement, in order to apply. Though the result in these cases has not been entirely unexpected, especially in the aftermath of the Rottmann ruling, it is rather problematic in that, although it is obvious that the Court wishes to redraw the line dividing the national and EU spheres of competence, it does not make it entirely clear where this line now lies and leaves many essential questions unanswered, which will obviously require some time to be resolved. EU lawyers are consequently, once more, left with having to decipher as best as they can the real intentions of the Court in this new line of case-law, which has been further complicated by the fact that what the Court seems to have given with one hand in Zambrano (and before that in Rottmann), has taken it back to a large extent through its rulings in McCarthy and Dereci, which appear to confine the former two cases to their own exceptional facts.6 Moreover, the ‘reverse discrimination Pandora’s box’, the opening of which appears to have been the real target of these references, remains untouched: instead of providing a direct solution to this problem, the Court has chosen to – once again – broaden the scope of the Treaty provisions in order to include within it as many situations as possible and, thus, prevent the emergence of this type of differential treatment on a case-by-case basis.As will be explained, nonetheless, this is by no means an appropriate solution to the reverse discrimination conundrum.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A straightforward procedure (assuming spherical symmetry) is described, which enables the unwanted small-angle component of the scattering for a finite model to be calculated. The method may be applied to models of any shape or size. It is illustrated by means of a single polymer chain.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A systematic approach is presented for obtaining cylindrical distribution functions (CDF's) of noncrystalline polymers which have been oriented by extension. The scattering patterns and CDF's are also sharpened by the method proposed by Deas and by Ruland. Data from atactic poly(methyl methacrylate) and polystyrene are analysed by these techniques. The methods could also be usefully applied to liquid crystals.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A two-dimensional X-ray scattering system developed around a CCD-based area detector is presented, both in terms of hardware employed and software designed and developed. An essential feature is the integration of hardware and software, detection and sample environment control which enables time-resolving in-situ wide-angle X-ray scattering measurements of global structural and orientational parameters of polymeric systems subjected to a variety of controlled external fields. The development and operation of a number of rheometers purpose-built for the application of such fields are described. Examples of the use of this system in monitoring degrees of shear-induced orientation in liquid-crystalline systems and crystallization of linear polymers subsequent to shear flow are presented.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Platinum is one of the most common coatings used to optimize mirror reflectivity in soft X-ray beamlines. Normal operation results in optics contamination by carbon-based molecules present in the residual vacuum of the beamlines. The reflectivity reduction induced by a carbon layer at the mirror surface is a major problem in synchrotron radiation sources. A time-dependent photoelectron spectroscopy study of the chemical reactions which take place at the Pt(111) surface under operating conditions is presented. It is shown that the carbon contamination layer growth can be stopped and reversed by low partial pressures of oxygen for optics operated in intense photon beams at liquidnitrogen temperature. For mirrors operated at room temperature the carbon contamination observed for equivalent partial pressures of CO is reduced and the effects of oxygen are observed on a long time scale.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Bovine viral diarrhoea virus (BVDV) is an economically important animal pathogen which is closely related to Hepatitis C virus. Of the structural proteins, the envelope glycoprotein E2 of BVDV is the major antigen which induces neutralizing antibodies; thus, BVDV E2 is considered as an ideal target for use in subunit vaccines. Here, the expression, purification of wild-type and mutant forms of the ectodomain of BVDV E2 and subsequent crystallization and data collection of two crystal forms grown at low and neutral pH are reported. Native and multiple-wavelength anomalous dispersion (MAD) data sets have been collected and structure determination is in progress.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

At least three ferritins are found in the bacterium Escherichia coli, the heme-containing bacterioferritin (EcBFR) and two non-heme bacterial ferritins (EcFtnA and EcFtnB). In addition to the conserved A- and B-sites of the diiron ferroxidase center, EcFtnA has a third iron-binding site (the C-site) of unknown function that is nearby the diiron site. In the present work, the complex chemistry of iron oxidation and deposition in EcFtnA has been further defined through a combination of oximetry, pH stat, stopped-flow and conventional kinetics, UV-visible, fluorescence and EPR spectroscopic measurements on the wildtype protein and site-directed variants of the A-, B- and C-sites. The data reveal that, while H2O2 is a product of dioxygen reduction in EcFtnA and oxidation occurs with a stoichiometry of Fe(II)/O2 ~ 3:1, most of the H2O2 produced is consumed in subsequent reactions with a 2:1 Fe(II)/H2O2 stoichiometry, thus suppressing hydroxyl radical formation. While the A- and B-sites are essential for rapid iron oxidation, the C-site slows oxidation and suppresses iron turnover at the ferroxidase center. A tyrosyl radical, assigned to Tyr24 near the ferroxidase center, is formed during iron oxidation and its possible significance to the function of the protein is discussed. Taken as a whole, the data indicate that there are multiple iron-oxidation pathways in EcFtnA with O2 and H2O2 as oxidants. Furthermore, the data are inconsistent with the C-site being a transit site, providing iron to the A- and B-sites, and does not support a universal mechanism for iron oxidation in all ferritins as recently proposed.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The book is a study of the New Party formed by Sir Oswald Mosley in 1931 following his leaving the Labour Party and prior to his forming the British Union of Fascists. It examines Mosley's transition from socialism to fascism within the wider context of British politics between the wars.