110 resultados para Dental x-ray
Resumo:
A novel bis(glycinato) copper(II) paradodecatungstate Na-8[{Cu(gly)(2)}(2)]-{H-2(H2W12O42)}] center dot 24H(2)O (1) has been synthesized under hydrothermal conditions. The crystal structure of 1 reveals an infinite one-dimensional chain along the [100] direction and is built from paradodecatungstate (H2W12O42)(10-) clusters joined through [Cu(gly)(2)] moieties. Parallel chains are interlinked by NaO6 octahedra to generate a two-dimensional network.
Resumo:
The crystallization of well-defined poly(L-lactide)-b-poly(epsilon-caprolactone) diblock copolymers, PLLA-b-PCL, was investigated by time-resolved X-ray techniques, polarized optical microscopy (POM), and differential scanning calorimetry (DSC). Two compositions were studied that contained 44 and 60 wt % poly(L-lactide), PLLA (they are referred to as (L44C5614)-C-11 and (L60C409)-C-12, respectively, with the molecular weight of each block in kg/mol as superscript). The copolymers were found to be initially miscible in the melt according to small-angle X-ray scattering measurements (SAXS). Their thermal behavior was also indicative of samples whose crystallization proceeds from a mixed melt. Sequential isothermal crystallization from the melt at 100 degreesC (for 30 min) and then at 30 degreesC (for 15 min) was measured. At 100 degreesC only the PLLA block is capable of crystallization, and its crystallization kinetics was followed by both WAXS and DSC; comparable results were obtained that indicated an instantaneous nucleation with three-dimensional superstructures (Avrami index of approximately 3). The spherulitic nature of the superstructure was confirmed by POM. When the temperature was decreased to 30 degreesC, the PCL block was able to crystallize within the PLLA negative spherulites (with an Avrami index of 2, as opposed to 3 in homo-PCL), and its crystallization rate was much slower than an equivalent homo-PCL. Time-resolved SAXS experiments in (L60C409)-C-12 revealed an initial melt mixed morphology at 165 degreesC that upon cooling transformed into a transient microphase-separated lamellar structure prior to crystallization at 100 degreesC.
Resumo:
Acridine-4-carboxamides form a class of known DNA mono-intercalating agents that exhibit cytotoxic activity against tumour cell lines due to their ability to inhibit topoisomerases. Previous studies of bis-acridine derivatives have yielded equivocal results regarding the minimum length of linker necessary between the two acridine chromophores to allow bis-intercalation of duplex DNA. We report here the 1.7 angstrom resolution X-ray crystal structure of a six-carbon-linked bis(acridine-4-carboxamide) ligand bound to d(CGTACG)(2) molecules by non-covalent duplex cross-linking. The asymmetric unit consists of one DNA duplex containing an intercalated acridine-4-carboxamide chromophore at each of the two CG steps. The other half of each ligand is bound to another DNA molecule in a symmetry-related manner, with the alkyl linker threading through the minor grooves. The two crystallographically independent ligand molecules adopt distinct side chain interactions, forming hydrogen bonds to either O6 or N7 on the major groove face of guanine, in contrast to the semi-disordered state of mono-intercalators bound to the same DNA molecule. The complex described here provides the first structural evidence for the non-covalent cross-linking of DNA by a small molecule ligand and suggests a possible explanation for the inconsistent behaviour of six-carbon linked bis-acridines in previous assays of DNA bis-intercalation.
Resumo:
Two octahedral complexes [Ni(HL1)(2)](ClO4)(2) (1) and [Ni(HL2)(2)](ClO4)(2) (2) and a square planar complex [Ni(HL3)]ClO4 (3) have been prepared, where [HL1 = 3-(2-amino-ethylimino)-butan-2-one oxime, HL2 = 3-(2-amino-propylimino)butan-2-one oxime] and H2L3 = 3-[2-(3-hydroxy-1-methyl-but-2-enylideneamino)-1-methyl-ethylimino]-buta n-2-one oxime. All the complexes have been characterized by elemental analyses, spectral studies and room temperature magnetic moment measurements. The molecular structures of all three compounds were elucidated on the basis of X-ray crystallography: complexes 1 and 2 are seen to be the met isomers. (C) 2008 Elsevier Ltd. All rights reserved.
Resumo:
Thallium cation complexation by calix[4]tubes has been investigated by a combination of (TI)-T-205, H-1 NMR and ES MS demonstrating the solution formation of a dithallium complex in which the cations are held in the calix[4]arene cavities. In addition, the structure of the complex has been determined in the solid state revealing the cations to be held exclusively by pi-cation interactions. Furthermore, this crystal structure has been used as the basis for molecular dynamics simulations to confirm that binding of the smaller K+ cation in the calix[4]tube cryptand like array occurs via the axial route featuring a g-cation intermediate.
Resumo:
Six ruthenium(II) complexes have been prepared using the tridentate ligands 2,6-bis(benzimidazolyl) pyridine and bis(2-benzimidazolyl methyl) amine and having 2,2'-bipyridine, 2,2':6',2 ''-terpyridine, PPh3, MeCN and chloride as coligands. The crystal structures of three of the complexes trans-[Ru(bbpH(2))(PPh3)(2)(CH3CN)I(ClO4)(2) center dot 2H(2)O (2), [Ru(bbpH(2))(bpy)Cl]ClO4 (3) and [Ru(bbpH(2))(terpy)](ClO4)(2) (4) are also reported. The complexes show visible region absorption at 402-517 nm, indicating that it is possible to tune the visible region absorption by varying the ancillary ligand. Luminescence behavior of the complexes has been studied both at RT and at liquid nitrogen temperature (LNT). Luminescence of the complexes is found to be insensitive to the presence of dioxygen. Two of the complexes [Ru(bbpH(2))(bpy)Cl]ClO4 (3) and [Ru(bbpH(2))(terpy]ClO4)(2) (4) show RT emission in the NIR region, having lifetime, quantum yield and radiative constant values suitable for their application as NIR emitter in the solid state devices. The DFT calculations on these two complexes indicate that the metal t(2g) electrons are appreciably delocalized over the ligand backbone. (C) 2006 Elsevier B.V. All rights reserved.
Resumo:
In this paper, we give an overview of our studies by static and time-resolved X-ray diffraction of inverse cubic phases and phase transitions in lipids. In 1, we briefly discuss the lyotropic phase behaviour of lipids, focusing attention on non-lamellar structures, and their geometric/topological relationship to fusion processes in lipid membranes. Possible pathways for transitions between different cubic phases are also outlined. In 2, we discuss the effects of hydrostatic pressure on lipid membranes and lipid phase transitions, and describe how the parameters required to predict the pressure dependence of lipid phase transition temperatures can be conveniently measured. We review some earlier results of inverse bicontinuous cubic phases from our laboratory, showing effects such as pressure-induced formation and swelling. In 3, we describe the technique of pressure-jump synchrotron X-ray diffraction. We present results that have been obtained from the lipid system 1:2 dilauroylphosphatidylcholine/lauric acid for cubic-inverse hexagonal, cubic-cubic and lamellar-cubic transitions. The rate of transition was found to increase with the amplitude of the pressure-jump and with increasing temperature. Evidence for intermediate structures occurring transiently during the transitions was also obtained. In 4, we describe an IDL-based 'AXCESS' software package being developed in our laboratory to permit batch processing and analysis of the large X-ray datasets produced by pressure-jump synchrotron experiments. In 5, we present some recent results on the fluid lamellar-Pn3m cubic phase transition of the single-chain lipid 1-monoelaidin, which we have studied both by pressure-jump and temperature-jump X-ray diffraction. Finally, in 6, we give a few indicators of future directions of this research. We anticipate that the most useful technical advance will be the development of pressure-jump apparatus on the microsecond time-scale, which will involve the use of a stack of piezoelectric pressure actuators. The pressure-jump technique is not restricted to lipid phase transitions, but can be used to study a wide range of soft matter transitions, ranging from protein unfolding and DNA unwinding and transitions, to phase transitions in thermotropic liquid crystals, surfactants and block copolymers.
Resumo:
We have investigated the effect of sample hydration on the wide-angle X-ray scattering patterns of amyloid fibrils from two different sources, hen egg white lysozyme (HEWL) and an 11-residue peptide taken from the sequence of transthyretin (TTR105-115). Both samples show an inter-strand reflection at 4.7 Å and an inter-sheet reflection which occurs at 8.8 and 10 Å for TTR105-115 and HEWL fibrils, respectively. The positions, widths, and relative intensities of these reflections are conserved in patterns obtained from dried stalks and hydrated samples over a range of fibril concentrations. In 2D scattering patterns obtained from flow-aligned hydrated samples, the inter-strand and inter-sheet reflections showed, respectively, axial and equatorial alignment relative to the fibril axis, characteristic of the cross-β structure. Our results show that the cross-β structure of the fibrils is not a product of the dehydrating conditions typically employed to produce aligned samples, but is conserved in individual fibrils in hydrated samples under dilute conditions comparable to those associated with other biophysical and spectroscopic techniques. This suggests a structure consisting of a stack of two or more sheets whose interfaces are inaccessible to bulk water.
Resumo:
Reaction of the tridentate ONO Schiff-base ligand 2-hydroxybenzoylhydrazone of 2-hydroxybenzoylhydrazine (H2L) with VO(acac)(2) in ethanol medium produces the oxoethoxovanadium(V) complex [VO(OEt)L] (A), which reacts with pyridine to form [VO(OEt)L center dot(py)] (1). Complex 1 is structurally characterized. It has a distorted octahedral O4N2 coordination environment around the V(V) acceptor center. Both complexes A and 1 in ethanol medium react with neutral monodentate Lewis bases 2-picoline, 3-picoline, 4-picoline, 4-amino pyridine, imidazole, and 4-methyl imidazole, all of which are stronger bases than pyridine, to produce dioxovanadium(V) complexes of general formula BH[VO2L]. Most of these dioxo complexes are structurally characterized, and the complex anion [VO2L](-) is found to possess a distorted square pyramidal structure. When a solution/suspension of a BH[VO2L] complex in an alcohol (ROH) is treated with HCl in the same alcohol, it is converted into the corresponding monooxoalkoxo complex [ O(OR)L], where R comes from the alcohol used as the reaction medium. Both complexes A and 1 produce the 4,4'-bipyridine-bridged binuclear complex [VO(OEt)L](2)(mu-4,4'-bipy) (2), which, to the best of our knowledge, represents the first report of a structurally characterized 4,4'-bipyridine-bridged oxovanadium(V) binuclear complex. Two similar binuclear oxovanadium(V) complexes 3 and 4 are also synthesized and characterized. All these binuclear complexes (2-4), on treatment with base B, produce the corresponding mononuclear dioxovanadium(V) complexes (5-10).
Resumo:
A fully automated procedure to extract and to image local fibre orientation in biological tissues from scanning X-ray diffraction is presented. The preferred chitin fibre orientation in the flow sensing system of crickets is determined with high spatial resolution by applying synchrotron radiation based X-ray microbeam diffraction in conjunction with advanced sample sectioning using a UV micro-laser. The data analysis is based on an automated detection of azimuthal diffraction maxima after 2D convolution filtering (smoothing) of the 2D diffraction patterns. Under the assumption of crystallographic fibre symmetry around the morphological fibre axis, the evaluation method allows mapping the three-dimensional orientation of the fibre axes in space. The resulting two-dimensional maps of the local fibre orientations - together with the complex shape of the flow sensing system - may be useful for a better understanding of the mechanical optimization of such tissues.
Resumo:
The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.
Resumo:
Solvent influences on the crystallization of polymorph and hydrate forms of the nootropic drug piracetam (2-oxo-pyrrolidineacetamide) were investigated from water, methanol, 2-propanol, isobutanol, and nitromethane. Crystal growth profiles of piracetam polymorphs were constructed using time-resolved diffraction snapshots collected for each solvent system. Measurements were performed by in situ energy dispersive X-ray diffraction recorded in Station 16.4 at the synchrotron radiation source (SRS) at Daresbury Laboratory, CCLRC UK. Crystallizations from methanol, 2-propanol, isobutanol, and nitromethane progressed in a similar fashion with the initial formation of form I which then converted relatively quickly to form II with form III being generated upon further cooling. However, considerable differences were observed for the polymorphs lifetime and both the rate and temperature of conversion using the different solvents. The thermodynamically unstable form I was kinetically favored in isobutanol and nitromethane where traces of this polymorph were observed below 10 degrees C. In contrast, the transformation of form II and subsequent growth of form III were inhibited in 2-propanol and nitromethane solutions. Aqueous solutions produced hydrate forms of piracetam which are different from the reported monohydrate; this crystallization evolved through successive generation of transient structures which transformed upon exchange of intramolecular water between the liquid and crystalline phases. (c) 2007 Wiley-Liss, Inc. and the American Pharmacists Association J Pharm Sci 96:1069-1078, 2007.
Resumo:
This paper describes a method for reconstructing 3D frontier points, contour generators and surfaces of anatomical objects or smooth surfaces from a small number, e. g. 10, of conventional 2D X-ray images. The X-ray images are taken at different viewing directions with full prior knowledge of the X-ray source and sensor configurations. Unlike previous works, we empirically demonstrate that if the viewing directions are uniformly distributed around the object's viewing sphere, then the reconstructed 3D points automatically cluster closely on a highly curved part of the surface and are widely spread on smooth or flat parts. The advantage of this property is that the reconstructed points along a surface or a contour generator are not under-sampled or under-represented because surfaces or contours should be sampled or represented with more densely points where their curvatures are high. The more complex the contour's shape, the greater is the number of points required, but the greater the number of points is automatically generated by the proposed method. Given that the number of viewing directions is fixed and the viewing directions are uniformly distributed, the number and distribution of the reconstructed points depend on the shape or the curvature of the surface regardless of the size of the surface or the size of the object. The technique may be used not only in medicine but also in industrial applications.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.