Gas-solid reactions of single crystals: a study of the reaction of bromine with single crystals of trans-cinnamic acid and a range of its derivatives by infrared and Raman microspectroscopy

Single crystals of trans-cinnamic acid and of a range of derivatives of this compound containing halogen substituents on the aromatic ring have been reacted with 165 Torr pressure of bromine vapour in a sealed desiccator at 20 degrees C for 1 week. Infrared and Raman microspectroscopic examination of the crystals shows that bromination of the aliphatic double bond, but not of the aromatic ring, has occurred. It is demonstrated also that the reaction is truly gas-solid in nature. A time-dependent study of these reactions shows that they do not follow a smooth diffusion-controlled pathway. Rather the reactions appear to be inhomogeneous and to occur at defects within the crystal. The reaction products are seen to flake from the surface of the crystal. It is shown, therefore, that these are not single crystal to single crystal transitions, as have been observed previously for the photodimerisation of trans-cinnamic acid and several of its derivatives. It is shown that there are no by-products of the reaction and that finely ground samples react to form the same products as single crystals.

Recovery of gallic acid with colloidal gas aphrons (CGA)

In the present paper the potential application of colloidal gas aphrons (CGA) to the recovery of antioxidants from wine-making waste extracts is investigated. CGA were generated by stirring a buffered solution (400 ml) of a cationic surfactant(cetyltrimethylammonium bromide, CTAB) at 8000 rpm for 10 minutes. Trials were carried out on standard solutions (2 ml) of gallic acid (GA) 200 mg/l with varying volumes of colloidal gas aphrons (20-60 ml) generated with varying concentrations of CTAB (2 and 4 mM). Influence of pH, solvent (buffered aqueous solution and ethanol), CTAB to GA molar ratio on recovery were studied. Best recovery (63%) was achieved from an aqueous solution of GA and at a CTAB to GA molar ratio of 16. Separation is mainly driven by electrostatic interactions but pH conditions are to be optimised to preserve the GA antioxidant power.

Recovery of lactoferrin and lactoperoxidase from sweet whey using colloidal gas aphrons (CGAs) generated from an anionic surfactant, AOT

The recovery of lactoferrin and lactoperoxidase from sweet whey was studied using colloidal gas aphrons (CGAs), which are surfactant-stabilized microbubbles (10-100 mum). CGAs are generated by intense stirring (8000 rpm for 10 min) of the anionic surfactant AOT (sodium bis-2-ethylhexyl sulfosuccinate). A volume of CGAs (10-30 mL) is mixed with a given volume of whey (1 - 10 mL), and the mixture is allowed to separate into two phases: the aphron (top) phase and the liquid (bottom) phase. Each of the phases is analyzed by SDS-PAGE and surfactant colorimetric assay. A statistical experimental design has been developed to assess the effect of different process parameters including pH, ionic strength, the concentration of surfactant in the CGAs generating solution, the volume of CGAs and the volume of whey on separation efficiency. As expected pH, ionic strength and the volume of whey (i.e. the amount of total protein in the starting material) are the main factors influencing the partitioning of the Lf(.)Lp fraction into the aphron phase. Moreover, it has been demonstrated that best separation performance was achieved at pH = 4 and ionic strength = 0.1 mol/L i.e., with conditions favoring electrostatic interactions between target proteins and CGAs (recovery was 90% and the concentration of lactoferrin and lactoperoxidase in the aphron phase was 25 times higher than that in the liquid phase), whereas conditions favoring hydrophobic interactions (pH close to pI and high ionic strength) led to lower performance. However, under these conditions, as confirmed by zeta potential measurements, the adsorption of both target proteins and contaminant proteins is favored. Thus, low selectivity is achieved at all of the studied conditions. These results confirm the initial hypothesis that CGAs act as ion exchangers and that the selectivity of the process can be manipulated by changing main operating parameters such as type of surfactant, pH and ionic strength.

An insight into the mechanism of protein separation by colloidal gas aphrons (CGA) generated from ionic surfactants

Colloidal gas aphrons (CGA), which are surfactant stabilised microbubbles, have been previously applied for the recovery of proteins from model mixtures and a few studies have demonstrated the potential of these dispersions for the selective recovery of proteins from complex mixtures. However there is a lack of understanding of the mechanism of separation and forces governing the selectivity of the separation. In this paper a mechanistic study is carried out to determine the main factors and forces influencing the selectivity of separation of whey proteins with CGA generated from ionic surfactants. Two different separation strategies were followed: (i) separation of lactoferrin and lactoperoxidase by anionic CGA generated from a solution of sodium bis-(2-ethyl hexyl) sulfosuccinate (AOT); (ii) separation of beta-lactoglobulin by cationic CGA generated from a solution of cetyltrimethylammonium bromide (CTAB). Separation results indicate that electrostatic interactions are the main forces determining the selectivity however these could not completely explain the selectivities obtained following both strategies. Protein-surfactant interactions were studied by measuring the zeta potential changes on individual proteins upon addition of surfactant and at varying pH. Interestingly strongest electrostatic interactions were measured at those pH and surfactant to protein mass ratios which were optimum for protein separation. Effect of surfactant on protein conformation was determined by measuring the change in fluorescence intensity upon addition of surfactant at varying pH. Differences in the fluorescence patterns were detected among proteins which were correlated to differences in their conformational features which could in turn explain their different separation behaviour. The effect of conformation on selectivity was further proven by experiments in which conformational changes were induced by pre-treatment of whey (heating) and by storage at 4 degrees C. Overall it can be concluded that separation of proteins by ionic CGA is driven mainly by electrostatic interactions however conformational features will finally determine the selectivity of the separation with competitive adsorption having also an effect. (c) 2006 Elsevier B.V. All rights reserved.

Recovery of astaxanthin using colloidal gas aphrons (CGA): a mechanistic study

The aim of this study is to investigate the mechanism responsible for the recovery of astaxanthin using Colloidal Gas Aphrons (CGA), which are surfactant stabilised microbubbles. The latter were produced using different surfactant solutions (Cetyl Trimethyl Ammonium Bromide (CTAB)-cationic, Sodium Dodecyl Sulfate (SDS)-anionic, TWEEN 60-non-ionic and mixtures of TWEEN 60-SPAN 80- non-ionic with varying hydrophobicity) at stirring speed 8000 rpm and stirring time 5 min. Experiments were carried out at varying pH and volumetric ratios of astaxanthin to CGA, and with two different astaxanthin standard suspensions: (i) astaxanthin dispersed in aqueous solutions and (ii) astaxanthin dispersed in ethanolic/aqueous solutions with different compositions of ethanol (20/80 (v/v) and 40/60 (v/v)). When astaxanthin is dispersed in aqueous solutions the separation seems to occur mainly by electrostatic interactions. Therefore the recoveries are higher in the case of the cationic surfactant when astaxanthin particles are strongly negatively charged, as shown by the zeta potential measurements. When ethanol is present, highest recoveries are achieved with CGA produced from the non-ionic surfactant, which indicates that, under these conditions, separation is driven mainly by hydrophobic interactions. In experiments with ethanolic/aqueous suspensions, when the hydrophobicity of the surfactant was increased by increasing volumes of SPAN 80, the CGA produced were less stable; thus higher recoveries of astaxanthin under conditions that favour hydrophobic interactions were not observed. (C) 2008 Elsevier B.V All rights reserved.

The use of colloidal gas aphrons as novel downstream processing for the recovery of astaxanthin from cells of Phaffia rhodozyma

BACKGROUND: There is an increasing interest in obtaining natural products with bioactive properties, using fermentation technology. However, the downstream processing consisting of multiple steps can be complicated, leading to increase in the final cost of the product. Therefore there is a need for integrated, cost-effective and scalable separation processes. RESULTS: The present study investigates the use of colloidal gas aphrons (CGA), which are surfactant-stabilized microbubbles, as a novel method for downstream processing. More particularly, their application for the recovery of astaxanthin from the cells of Phaffia rhodozyma is explored. Research carried out with standard solutions of astaxanthin and CGA generated from the cationic surfactant hexadecyl. trimethyl ammonium bromide (CTAB) showed that up to 90% recovery can be achieved under optimum conditions, i.e., pH 11 with NaOH 0.2 mol L-1. In the case of the cells' suspension from the fermentation broth, three different approaches were investigated: (a) the conventional integrated approach where CGA were applied directly; (b) CGA were applied to the clarified suspension of cells; and finally (c) the in situ approach, where CGA are generated within the clarified suspension of cells. Interestingly, in the case of the whole suspension (approach a) highest recoveries (78%) were achieved under the same conditions found to be optimal for the standard solutions. In addition, up to 97% recovery of total carotenoids could be achieved from the clarified suspension after pretreatment with NaOH. This pretreatment led to maximum cell disruption as well as optimum conditioning for subsequent CGA separation. CONCLUSIONS: These results demonstrate the potential of CGA for the recovery of bioactive components from complex feedstock. (c) 2008 Society of Chemical Industry.

Recovery of norbixin from a raw extraction solution of annatto pigments using colloidal gas aphrons (CGAs)

Annatto dyes are widely used in food and are finding increasing interest also for their application in the pharmaceutical and cosmetics industry. Bixin is the main pigment extracted from annatto seeds and accounts for 80% of the carotenoids in the outer coat of the seeds; norbixin being the water-soluble form of the bixin. Typically annatto dyes are extracted from the seeds by mechanical means or solutions of alkali, edible oil or organic solvents, or a combination of the two depending on the desired final product. In this work CGAs are investigated as an alternative separation method for the recovery of norbixin from a raw extraction solution of annatto pigments in KOH. A volume of CGAs generated from a cationic surfactant (CTAB) solution is mixed with a volume of annatto solution and when the mixture is allowed to settle it separates into the top aphron phase and the bottom liquid phase. Potassium norbixinate presented in the annatto solution will interact with the surfactant in the aphron phase, which results in the effective separation of norbixin. Recovery= 94% was achieved at a CTAB to norbixin molar ratio of 3.3. In addition a mechanism of separation is proposed here based on the separation results with the cationic surfactant and an anionic surfactant (bis-2-ethyl hexyl sulfosuccinate, AOT) and measurements of surfactant to norbixin ratio in the aphron phase; electrostatic interactions between the surfactant and norbixin molecules result in the fort-nation of a coloured complex and effective separation of norbixin. (c) 2005 Elsevier B.V. All rights reserved.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Mechanistic insights into a gas–solid reaction in molecular crystals: the role of hydrogen bonding

Reactions in (molecular) organic crystalline solids have been shown to be important for exerting control that is unattainable over chemical transformations in solution. Such control has also been achieved for reactions within metal– organic cages. In these examples, the reactants are already in place within the crystals following the original crystal growth. The post-synthetic modification of metal–organic frameworks (MOFs and indeed reactions and catalysis within MOFs have been recently demonstrated; in these cases the reactants enter the crystals through permanent channels. Another growing area of interest within molecular solid-state chemistry is synthesis by mechanical co-grinding of solid reactants—often referred to as mechanochemistry. Finally, in a small number of reported examples, molecules also have been shown to enter nonporous crystals directly from the gas or vapor phase, but in only a few of these examples does a change in covalent bonding result, which indicates that a reaction occurs within the nonporous crystals. It is this latter type of highly uncommon reaction that is the focus of the present study.

Ice crystals growing from vapor in supercooled clouds between −2.5° and −22°C: testing current parameterization methods using laboratory data

The physical and empirical relationships used by microphysics schemes to control the rate at which vapor is transferred to ice crystals growing in supercooled clouds are compared with laboratory data to evaluate the realism of various model formulations. Ice crystal growth rates predicted from capacitance theory are compared with measurements from three independent laboratory studies. When the growth is diffusion- limited, the predicted growth rates are consistent with the measured values to within about 20% in 14 of the experiments analyzed, over the temperature range −2.5° to −22°C. Only two experiments showed significant disagreement with theory (growth rate overestimated by about 30%–40% at −3.7° and −10.6°C). Growth predictions using various ventilation factor parameterizations were also calculated and compared with supercooled wind tunnel data. It was found that neither of the standard parameterizations used for ventilation adequately described both needle and dendrite growth; however, by choosing habit-specific ventilation factors from previous numerical work it was possible to match the experimental data in both regimes. The relationships between crystal mass, capacitance, and fall velocity were investigated based on the laboratory data. It was found that for a given crystal size the capacitance was significantly overestimated by two of the microphysics schemes considered here, yet for a given crystal mass the growth rate was underestimated by those same schemes because of unrealistic mass/size assumptions. The fall speed for a given capacitance (controlling the residence time of a crystal in the supercooled layer relative to its effectiveness as a vapor sink, and the relative importance of ventilation effects) was found to be overpredicted by all the schemes in which fallout is permitted, implying that the modeled crystals reside for too short a time within the cloud layer and that the parameterized ventilation effect is too strong.

Separation of astaxanthin from cells of Phaffia rhodozyma using colloidal gas aphrons (CGA) in a flotation column

The aim of this study is to investigate the separation of astaxanthin from the cells of Phaffia rhodozyma using colloidal gas aphrons (CGA), which are surfactant stabilized microbubbles, in a flotation column. It was reported in previous studies that optimum recoveries are achieved at conditions that favor electrostatic interactions. Therefore, in this study, CGA generated from the cationic surfactant hexadecyl trimethyl ammonium bromide (CTAB) were applied to suspensions of cells pretreated with NaOH. The different operation modes (batch or continuous) and the effect of volumetric ratio of CGA to feed, initial concentration of feed, operating height, and flow rate of CGA on the separation of astaxanthin were investigated. The volumetric ratio was found to have a significant effect on the separation of astaxanthin for both batch and continuous experiments. Additionally, the effect of homogenization of the cells on the purity of the recovered fractions was investigated, showing that the homogenization resulted in increased purity. Moreover, different concentrations of surfactant were used for the generation of CGA for the recovery of astaxanthin on batch mode; it was found that recoveries up to 98% could be achieved using CGA generated from a CTAB solution 0.8 mM, which is below the CTAB critical micellar concentration (CMC). These results offer important information for the scale-up of the separation of astaxanthin from the cells of P. rhodozyma using CGA.

Recovery of gallic acid with colloidal gas aphrons generated from a cationic surfactant

In a previous study we have demonstrated that gallic acid (GA) in its anionic form can be recovered from aqueous solutions using colloidal gas aphrons (CGA) generated from the cationic surfactant cetyltrimethylammonium bromide (CTAB). The aim of the present work is to get a better understanding of the separation mechanism in order to determine the optimum operating conditions to maximise the recovery of GA while preserving its antioxidant properties. Zeta potential measurements were carried out to characterise the surface charge of GA, CTAB and their mixtures at three different pH conditions (both in buffers and in aqueous solutions). GA interacted strongly with CTAB at pH higher than its pKa 3.14 where it is ionised and negatively charged. However, at pH higher than 7 GA becomes oxidised and loses its antioxidant power. GA recovery was mainly affected by pH, ionic strength, surfactant/GA molar ratio, mixing conditions and contact time. Scale-up of the separation using a flotation column resulted in both higher recovery and reproducibility. Preliminary experiments with grape marc extracts confirmed the potential application of this separation for the recovery of polyphenols from complex feedstocks

Evolution of network structure in polymer-stabilised liquid crystals

Experiments were performed to investigate the evolution of structure and morphology of the network in polymer-stabilised liquid crystals. In situ optical microscopy revealed that the morphology was significantly altered by extraction of the LC host, while scanning electron microscopy showed that the network morphology was also dependent on the polymerisation conditions and closely related to the depletion of monomer, as monitored by high performance liquid chromatography. Transmission electron microscopy allowed observation of internal structure, resolving microstructure on the order of 0. 1 μm.

A novel study of the polymerisation process involved in the formation of the network component of polymer-stabilised liquid crystals within electro-optic cells using high performance liquid chromatography

Polymer-stabilised liquid crystals are systems in which a small amount of monomer is dissolved within a liquid crystalline host, and then polymerised in situ to produce a network. The progress of the polymerisation, performed within electro-optic cells, was studied by establishing an analytical method novel to these systems. Samples were prepared by photopolymerisation of the monomer under well-defined reaction conditions; subsequent immersion in acetone caused the host and any unreacted monomer to dissolve. High performance liquid chromatography was used to separate and detect the various solutes in the resulting solutions, enabling the amount of unreacted monomer for a given set of conditions to be quantified. Longer irradiations cause a decrease in the proportion of unreacted monomer since more network is formed, while a more uniform LC director alignment (achieved by decreasing the sample thickness) or a higher level of order (achieved by decreasing the polymerisation temperature) promotes faster reactions.