259 resultados para Christine de Pisan
Resumo:
Objective The influences of genetic determinants on the magnitude of postprandial lipaemia are presently unclear. Here the impact of the common apolipoprotein (apo)E epsilon mutation on the postprandial triglyceride (TG) response is determined, along with an assessment of genotype penetrance according to age, body mass index and gender. Methods and results Healthy adults (n = 251) underwent a postprandial investigation, in which blood samples were taken at regular intervals after a test breakfast (0 min, 49 g fat) and lunch (330 min, 29 g fat) until 480 min after the test breakfast. There was a significant impact of apoE genotype on fasting total cholesterol (TC), (P = 0.027), LDL-cholesterol (LDL-C), (P = 0.008), and %LDL3 (P = 0.001), with higher and lower levels in the E4 and E2 carriers respectively relative to the E3/E3 genotype. Reflective of a higher fasting TG (P = 0.001), a significantly higher area under the curve for the postprandial TG response (TG AUC) was evident in the E4 carriers relative to the E3/E3 group (P = 0.038). In the group as a whole, a significant age × genotype interaction was observed for fasting TC (P = 0.021). In the participants >50 years there was a significant impact of genotype on TC (P = 0.005), LDL-C (P = 0.001) and TAG AUC (P = 0.028). Conclusions It is possible that an exaggerated postprandial lipaemia contributes to the increased coronary heart disease risk associated with carriers of the E4 allele; an effect which is more evident in older adults.
Resumo:
Hydroperoxidation studies on a series of alkene substrates demonstrate the introduction of the hydroperoxide functional group into the required position for a biosynthetically inspired synthesis of mycaperoxide B.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
Background:Excessive energy intake and obesity lead to the metabolic syndrome (MetS). Dietary saturated fatty acids (SFAs) may be particularly detrimental on insulin sensitivity (SI) and on other components of the MetS. Objective:This study determined the relative efficacy of reducing dietary SFA, by isoenergetic alteration of the quality and quantity of dietary fat, on risk factors associated with MetS. Design:A free-living, single-blinded dietary intervention study. Subjects and Methods:MetS subjects (n=417) from eight European countries completed the randomized dietary intervention study with four isoenergetic diets distinct in fat quantity and quality: high-SFA; high-monounsaturated fatty acids and two low-fat, high-complex carbohydrate (LFHCC) diets, supplemented with long chain n-3 polyunsaturated fatty acids (LC n-3 PUFAs) (1.2 g per day) or placebo for 12 weeks. SI estimated from an intravenous glucose tolerance test (IVGTT) was the primary outcome measure. Lipid and inflammatory markers associated with MetS were also determined. Results:In weight-stable subjects, reducing dietary SFA intake had no effect on SI, total and low-density lipoprotein cholesterol concentration, inflammation or blood pressure in the entire cohort. The LFHCC n-3 PUFA diet reduced plasma triacylglycerol (TAG) and non-esterified fatty acid concentrations (P<0.01), particularly in men. Conclusion:There was no effect of reducing SFA on SI in weight-stable obese MetS subjects. LC n-3 PUFA supplementation, in association with a low-fat diet, improved TAG-related MetS risk profiles.
Nonspherical assemblies generated from polystyrene-b-poly(L-lysine) polyelectrolyte block copolymers
Resumo:
This report describes the aqueous solution self-assembly of a series of polystyrene(m)-b-poly(L-lysine)n block copolymers (m = 8-10; n = 10-70). The polymers are prepared by ring-opening polymerization of epsilon-benzyloxycarbonyl-L-lysine N-carboxyanhydride using amine terminated polystyrene macroinitiators, followed by removal of the benzyloxycarbonyl side chain protecting groups. The critical micelle concentration of the block copolymers determined using the pyrene probe technique shows a parabolic dependence on peptide block length exhibiting a maximum at n = approximately 20 (m = 8) or n = approximately 60 (m = 10). The shape and size of the aggregates has been studied by dynamic and static light scattering, small-angle neutron scattering (SANS), and analytical ultracentrifugation (AUC). Surprisingly, Holtzer and Kratky analysis of the static light scattering results indicates the presence of nonspherical, presumably cylindrical objects independent of the poly(L-lysine)n block length. This is supported by SANS data, which can be fitted well by assuming cylindrical scattering objects. AUC analysis allows the molecular weight of the aggregates to be estimated as several million g/mol, corresponding to aggregation numbers of several 10s to 100s. These aggregation numbers agree with those that can be estimated from the length and diameter of the cylinders obtained from the scattering results.
Resumo:
Novel macrocyclic receptors which bind electron-donor aromatic substrates via π-stacking donor- acceptor interactions are obtained by cyclo-imidization of an amine-functionalized arylether-sulfone with pyromellitic- and 1,4,5,8-naphthalene-tetracarboxylic dianhydrides. These macrocycles complex with a wide variety of π-donor substrates including tetrathiafulvalene, naphthalene, anthracene, pyrene, perylene, and functional derivatives of these polycyclic hydrocarbons. The resulting supramolecular assemblies range from simple 1:1 complexes, to [2]- and [3]-pseudorotaxanes, and even (as a result of crystallographic disorder) an apparent polyrotaxane. Direct, five-component self-assembly of a metal-centred [3]pseudorotaxane is also observed, on complexation of a macrocyclic ether-imide with 8-hydroxyquinoline in the presence of palladium(II) ions. Binding studies in solution were carried out by 1H NMR and UV-visible spectroscopy, and the stoichiometries of binding were confirmed by Job plots based on charge-transfer absorption bands. The highest association constants are found for strong π-donor guests with large surface-areas, notably perylene and 1-hydroxypyrene, for which Ka values of 1.4 x 103 and 2.3 x 103 M-1 respectively are found. Single crystal X-ray analyses of the receptors and their derived complexes reveal large, induced-fit distortions of the macrocyclic frameworks as a result of complexation. These structures provide compelling evidence for the existence of strong, attractive forces between the electronically-complementary aromatic π-systems of host and guest.
Resumo:
Sequence-specific binding is demonstrated between pyrene-based tweezer molecules and soluble, high molar mass copolyimides. The binding involves complementary pi - pi stacking interactions, polymer chain-folding, and hydrogen bonding and is extremely sensitive to the steric environment around the pyromellitimide binding-site. A detailed picture of the intermolecular interactions involved has been obtained through single-crystal X-ray studies of tweezer complexes with model diimides. Ring-current magnetic shielding of polyimide protons by the pyrene '' arms '' of the tweezer molecule induces large complexation shifts of the corresponding H-1 NMR resonances, enabling specific triplet sequences to be identified by their complexation shifts. Extended comonomer sequences (triplets of triplets in which the monomer residues differ only by the presence or absence of a methyl group) can be '' read '' by a mechanism which involves multiple binding of tweezer molecules to adjacent diimide residues within the copolymer chain. The adjacent-binding model for sequence recognition has been validated by two conceptually different sets of tweezer binding experiments. One approach compares sequence-recognition events for copolyimides having either restricted or unrestricted triple-triplet sequences, and the other makes use of copolymers containing both strongly binding and completely nonbinding diimide residues. In all cases the nature and relative proportions of triple-triplet sequences predicted by the adjacent-binding model are fully consistent with the observed H-1 NMR data.
Resumo:
Cloud optical depth is one of the most poorly observed climate variables. The new “cloud mode” capability in the Aerosol Robotic Network (AERONET) will inexpensively yet dramatically increase cloud optical depth observations in both number and accuracy. Cloud mode optical depth retrievals from AERONET were evaluated at the Atmospheric Radiation Measurement program’s Oklahoma site in sky conditions ranging from broken clouds to overcast. For overcast cases, the 1.5 min average AERONET cloud mode optical depths agreed to within 15% of those from a standard ground‐based flux method. For broken cloud cases, AERONET retrievals also captured rapid variations detected by the microwave radiometer. For 3 year climatology derived from all nonprecipitating clouds, AERONET monthly mean cloud optical depths are generally larger than cloud radar retrievals because of the current cloud mode observation strategy that is biased toward measurements of optically thick clouds. This study has demonstrated a new way to enhance the existing AERONET infrastructure to observe cloud optical properties on a global scale.
Resumo:
An idealized equilibrium model for the undisturbed partly cloudy boundary layer (BL) is used as a framework to explore the coupling of the energy, water, and carbon cycles over land in midlatitudes and show the sensitivity to the clear‐sky shortwave flux, the midtropospheric temperature, moisture, CO2, and subsidence. The changes in the surface fluxes, the BL equilibrium, and cloud cover are shown for a warmer, doubled CO2 climate. Reduced stomatal conductance in a simple vegetation model amplifies the background 2 K ocean temperature rise to an (unrealistically large) 6 K increase in near‐surface temperature over land, with a corresponding drop of near‐surface relative humidity of about 19%, and a rise of cloud base of about 70 hPa. Cloud changes depend strongly on changes of mean subsidence; but evaporative fraction (EF) decreases. EF is almost uniquely related to mixed layer (ML) depth, independent of background forcing climate. This suggests that it might be possible to infer EF for heterogeneous landscapes from ML depth. The asymmetry of increased evaporation over the oceans and reduced transpiration over land increases in a warmer doubled CO2 climate.
An assessment of aerosol‐cloud interactions in marine stratus clouds based on surface remote sensing
Resumo:
An assessment of aerosol-cloud interactions (ACI) from ground-based remote sensing under coastal stratiform clouds is presented. The assessment utilizes a long-term, high temporal resolution data set from the Atmospheric Radiation Measurement (ARM) Program deployment at Pt. Reyes, California, United States, in 2005 to provide statistically robust measures of ACI and to characterize the variability of the measures based on variability in environmental conditions and observational approaches. The average ACIN (= dlnNd/dlna, the change in cloud drop number concentration with aerosol concentration) is 0.48, within a physically plausible range of 0–1.0. Values vary between 0.18 and 0.69 with dependence on (1) the assumption of constant cloud liquid water path (LWP), (2) the relative value of cloud LWP, (3) methods for retrieving Nd, (4) aerosol size distribution, (5) updraft velocity, and (6) the scale and resolution of observations. The sensitivity of the local, diurnally averaged radiative forcing to this variability in ACIN values, assuming an aerosol perturbation of 500 c-3 relative to a background concentration of 100 cm-3, ranges betwee-4 and -9 W -2. Further characterization of ACI and its variability is required to reduce uncertainties in global radiative forcing estimates.
Resumo:
Laser beams emitted from the Geoscience Laser Altimeter System (GLAS), as well as other spaceborne laser instruments, can only penetrate clouds to a limit of a few optical depths. As a result, only optical depths of thinner clouds (< about 3 for GLAS) are retrieved from the reflected lidar signal. This paper presents a comprehensive study of possible retrievals of optical depth of thick clouds using solar background light and treating GLAS as a solar radiometer. To do so one must first calibrate the reflected solar radiation received by the photon-counting detectors of the GLAS 532-nm channel, the primary channel for atmospheric products. Solar background radiation is regarded as a noise to be subtracted in the retrieval process of the lidar products. However, once calibrated, it becomes a signal that can be used in studying the properties of optically thick clouds. In this paper, three calibration methods are presented: (i) calibration with coincident airborne and GLAS observations, (ii) calibration with coincident Geostationary Opera- tional Environmental Satellite (GOES) and GLAS observations of deep convective clouds, and (iii) cali- bration from first principles using optical depth of thin water clouds over ocean retrieved by GLAS active remote sensing. Results from the three methods agree well with each other. Cloud optical depth (COD) is retrieved from the calibrated solar background signal using a one-channel retrieval. Comparison with COD retrieved from GOES during GLAS overpasses shows that the average difference between the two retriev- als is 24%. As an example, the COD values retrieved from GLAS solar background are illustrated for a marine stratocumulus cloud field that is too thick to be penetrated by the GLAS laser. Based on this study, optical depths for thick clouds will be provided as a supplementary product to the existing operational GLAS cloud products in future GLAS data releases.
Resumo:
Recent empirical studies have shown that multi-angle spectral data can be useful for predicting canopy height, but the physical reason for this correlation was not understood. We follow the concept of canopy spectral invariants, specifically escape probability, to gain insight into the observed correlation. Airborne Multi-Angle Imaging Spectrometer (AirMISR) and airborne Laser Vegetation Imaging Sensor (LVIS) data acquired during a NASA Terrestrial Ecology Program aircraft campaign underlie our analysis. Two multivariate linear regression models were developed to estimate LVIS height measures from 28 AirMISR multi-angle spectral reflectances and from the spectrally invariant escape probability at 7 AirMISR view angles. Both models achieved nearly the same accuracy, suggesting that canopy spectral invariant theory can explain the observed correlation. We hypothesize that the escape probability is sensitive to the aspect ratio (crown diameter to crown height). The multi-angle spectral data alone therefore may not provide enough information to retrieve canopy height globally.
Resumo:
Pulsed lidars are commonly used to retrieve vertical distributions of cloud and aerosol layers. It is widely believed that lidar cloud retrievals (other than cloud base altitude) are limited to optically thin clouds. Here, we demonstrate that lidars can retrieve optical depths of thick clouds using solar background light as a signal, rather than (as now) merely a noise to be subtracted. Validations against other instruments show that retrieved cloud optical depths agree within 10%–15% for overcast stratus and broken clouds. In fact, for broken cloud situations, one can retrieve not only the aerosol properties in clear-sky periods using lidar signals, but also the optical depth of thick clouds in cloudy periods using solar background signals. This indicates that, in general, it may be possible to retrieve both aerosol and cloud properties using a single lidar. Thus, lidar observations have great untapped potential to study interactions between clouds and aerosols.
Resumo:
Many clouds important to the Earth’s energy balance contain small amounts of liquid water, yet despite many improvements, large differences in retrievals of their liquid water amount and particle size still must be resolved.
Resumo:
We have conducted the first extensive field test of two new methods to retrieve optical properties for overhead clouds that range from patchy to overcast. The methods use measurements of zenith radiance at 673 and 870 nm wavelengths and require the presence of green vegetation in the surrounding area. The test was conducted at the Atmospheric Radiation Measurement Program Oklahoma site during September–November 2004. These methods work because at 673 nm (red) and 870 nm (near infrared (NIR)), clouds have nearly identical optical properties, while vegetated surfaces reflect quite differently. The first method, dubbed REDvsNIR, retrieves not only cloud optical depth τ but also radiative cloud fraction. Because of the 1-s time resolution of our radiance measurements, we are able for the first time to capture changes in cloud optical properties at the natural timescale of cloud evolution. We compared values of τ retrieved by REDvsNIR to those retrieved from downward shortwave fluxes and from microwave brightness temperatures. The flux method generally underestimates τ relative to the REDvsNIR method. Even for overcast but inhomogeneous clouds, differences between REDvsNIR and the flux method can be as large as 50%. In addition, REDvsNIR agreed to better than 15% with the microwave method for both overcast and broken clouds. The second method, dubbed COUPLED, retrieves τ by combining zenith radiances with fluxes. While extra information from fluxes was expected to improve retrievals, this is not always the case. In general, however, the COUPLED and REDvsNIR methods retrieve τ to within 15% of each other.