55 resultados para Antisense oligonucleotide


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The invention provides antisense antiviral compounds and methods of their use and production in inhibition of growth of viruses of the Arenaviridae family and in the treatment of a viral infection. The compounds are particularly useful in the treatment of Arenavirus infection in a mammal. The antisense antiviral compounds are substantially uncharged morpholino oligonucleotides have a sequence of 12-40 subunits, including at least 12 subunits having a targeting sequence that is complementary to a region associated with viral RNA sequences within a 19 nucleotide region of the 5′-terminal regions of the viral RNA, viral complementary RNA and/or mRNA identified by SEQ ID NO:1.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We have compiled two comprehensive gene expression profiles from mature leaf and immature seed tissue of rice (Oryza sativa ssp. japonica cultivar Nipponbare) using Serial Analysis of Gene Expression (SAGE) technology. Analysis revealed a total of 50 519 SAGE tags, corresponding to 15 131 unique transcripts. Of these, the large majority (approximately 70%) occur only once in both libraries. Unexpectedly, the most abundant transcript (approximately 3% of the total) in the leaf library was derived from a type 3 metallothionein gene. The overall frequency profiles of the abundant tag species from both tissues differ greatly and reveal seed tissue as exhibiting a non-typical pattern of gene expression characterized by an over abundance of a small number of transcripts coding for storage proteins. A high proportion ( approximately 80%) of the abundant tags (> or = 9) matched entries in our reference rice EST database, with many fewer matches for low abundant tags. Singleton transcripts that are common to both tissues were collated to generate a summary of low abundant transcripts that are expressed constitutively in rice tissues. Finally and most surprisingly, a significant number of tags were found to code for antisense transcripts, a finding that suggests a novel mechanism of gene regulation, and may have implications for the use of antisense constructs in transgenic technology.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background: Hexaploid wheat is one of the most important cereal crops for human nutrition. Molecular understanding of the biology of the developing grain will assist the improvement of yield and quality traits for different environments. High quality transcriptomics is a powerful method to increase this understanding. Results: The transcriptome of developing caryopses from hexaploid wheat ( Triticum aestivum, cv. Hereward) was determined using Affymetrix wheat GeneChip (R) oligonucleotide arrays which have probes for 55,052 transcripts. Of these, 14,550 showed significant differential regulation in the period between 6 and 42 days after anthesis ( daa). Large changes in transcript abundance were observed which were categorised into distinct phases of differentiation ( 6 - 10 daa), grain fill ( 12 - 21 daa) and desiccation/maturation ( 28 - 42 daa) and were associated with specific tissues and processes. A similar experiment on developing caryopses grown with dry and/or hot environmental treatments was also analysed, using the profiles established in the first experiment to show that most environmental treatment effects on transcription were due to acceleration of development, but that a few transcripts were specifically affected. Transcript abundance profiles in both experiments for nine selected known and putative wheat transcription factors were independently confirmed by real time RT-PCR. These expression profiles confirm or extend our knowledge of the roles of the known transcription factors and suggest roles for the unknown ones. Conclusion: This transcriptome data will provide a valuable resource for molecular studies on wheat grain. It has been demonstrated how it can be used to distinguish general developmental shifts from specific effects of treatments on gene expression and to diagnose the probable tissue specificity and role of transcription factors.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The adrenal cortex is a dynamic organ in which the cells of the outer cortex continually divide. It is well known that this cellular proliferation is dependent on constant stimulation from peptides derived from the ACTH precursor pro-opiomelanocortin (POMC) because disruption of pituitary corticotroph function results in rapid atrophy of the gland. Previous results from our laboratory have suggested that the adrenal mitogen is a fragment derived from the N-terminal of POMC not containing the gamma-MSH sequence. Because such a peptide is not generated during processing of POMC in the pituitary, we proposed that the mitogen is generated from circulating pro-gamma-MSH by an adrenal protease. Using degenerate oligonucleotides, we identified a secreted serine protease expressed by the adrenal gland that we named adrenal secretory protease (ASP). In the adrenal cortex, expression of ASP is limited to the outer zona glomerulosa/fasciculata, the region where cortical cells are believed to be derived, and is significantly up-regulated during compensatory growth. Y1 adrenocortical cells transfected with a vector expressing an antisense RNA (and thus having reduced levels of endogenous ASP) were found to grow slower than sense controls while also losing their ability to utilize exogenous pro-gamma-MSH in the media supporting a role for ASP in adrenal growth. Digestion of an N-POMC peptide substrate encompassing the residues around the dibasic cleavage site at positions 49/50 with affinity-purified ASP showed cleavage not to occur at the dibasic site but two residues downstream leading us to propose the identity of the adrenal mitogen to be N-POMC (1-52).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Identification of Fusarium species has always been difficult due to confusing phenotypic classification systems. We have developed a fluorescent-based polymerase chain reaction assay that allows for rapid and reliable identification of five toxigenic and pathogenic Fusarium species. The species includes Fusarium avenaceum, F. culmorum, F. equiseti, F. oxysporum and F. sambucinum. The method is based on the PCR amplification of species-specific DNA fragments using fluorescent oligonucleotide primers, which were designed based on sequence divergence within the internal transcribed spacer region of nuclear ribosomal DNA. Besides providing an accurate, reliable, and quick diagnosis of these Fusaria, another advantage with this method is that it reduces the potential for exposure to carcinogenic chemicals as it substitutes the use of fluorescent dyes in place of ethidium, bromide. Apart from its multidisciplinary importance and usefulness, it also obviates the need for gel electrophoresis. (C) 2002 Published by Elsevier Science B.V. on behalf of the Federation of European Microbiological Societies.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The distribution and activity of communities of sulfate-reducing bacteria (SRB) and methanogenic archaea in two contrasting Antarctic sediments were investigated. Methanogenesis dominated in freshwater Lake Heywood, while sulfate reduction dominated in marine Shallow Bay. Slurry experiments indicated that 90% of the methanogenesis in Lake Heywood was acetoclastic. This finding was supported by the limited diversity of clones detected in a Lake Heywood archaeal clone library, in which most clones were closely related to the obligate acetate-utilizing Methanosaeta concilii. The Shallow Bay archaeal clone library contained clones related to the C-1-utilizing Methanolobus and Methanococcoides and the H-2-utilizing Methanogenium. Oligonucleotide probing of RNA extracted directly from sediment indicated that archaea represented 34% of the total prokaryotic signal in Lake Heywood and that Methanosaeta was a major component (13.2%) of this signal. Archaea represented only 0.2% of the total prokaryotic signal in RNA extracted from Shallow Bay sediments. In the Shallow Bay bacterial clone library, 10.3% of the clones were SRB-like, related to Desulfotalea/Desulforhopalus, Desulfofaba, Desulfosarcina, and Desulfobacter as well as to the sulfur and metal oxidizers comprising the Desulfuromonas cluster. Oligonucleotide probes for specific SRB clusters indicated that SRB represented 14.7% of the total prokaryotic signal, with Desulfotalea/Desulforhopalus being the dominant SRB group (10.7% of the total prokaryotic signal) in the Shallow Bay sediments; these results support previous results obtained for Arctic sediments. Methanosaeta and Desulfotalea/Desulforhopalus appear to be important in Lake Heywood and Shallow Bay, respectively, and may be globally important in permanently low-temperature sediments.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The reaction of the redox-active ligand, Hpyramol (4-methyl-2-N-(2-pyridylmethyl)aminophenol) with K2PtCl4 yields monofunctional square-planar [Pt(pyrimol)Cl], PtL-Cl, which was structurally characterised by single-crystal X-ray diffraction and NMR spectroscopy. This compound unexpectedly cleaves supercoiled double-stranded DNA stoichiometrically and oxidatively, in a non-specific manner without any external reductant added, under physiological conditions. Spectro-electrochemical investigations of PtL-Cl were carried out in comparison with the analogue CuL-Cl as a reference compound. The results support a phenolate oxidation, generating a phenoxyl radical responsible for the ligand-based DNA cleavage property of the title compounds. Time-dependent in vitro cytotoxicity assays were performed with both PtL-Cl and CuL-Cl in various cancer cell lines. The compound CuL-Cl overcomes cisplatin-resistance in ovarian carcinoma and mouse leukaemia cell lines, with additional activity in some other cells. The platinum analogue, PtL-Cl also inhibits cell-proliferation selectively. Additionally, cellular-uptake studies performed for both compounds in ovarian carcinoma cell lines showed that significant amounts of Pt and Cu were accumulated in the A2780 and A2780R cancer cells. The conformational and structural changes induced by PtL-Cl and CuL-Cl on calf thymus DNA and phi X174 supercoiled phage DNA at ambient conditions were followed by electrophoretic mobility assay and circular dichroism spectroscopy. The compounds induce extensive DNA degradation and unwinding, along with formation of a monoadduct at the DNA minor groove. Thus, hybrid effects of metal-centre variation, multiple DNA-binding modes and ligand-based redox activity towards cancer cell-growth inhibition have been demonstrated. Finally, reactions of PtL-Cl with DNA model bases (9-Ethylguanine and 5'-GMP) followed by NMR and MS showed slow binding at Guanine-N7 and for the double stranded self complimentary oligonucleotide d(GTCGAC)(2) in the minor groove.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Recent rapid developments in biological analysis, medical diagnosis, pharmaceutical industry, and environmental control fuel the urgent need for recognition of particular DNA sequences from samples. Currently, DNA detection techniques use radiochemical, enzymatic, fluorescent, or electrochemiluminescent methods; however, these techniques require costly labeled DNA and highly skilled and cumbersome procedure, which prohibit any in-situ monitoring. Here, we report that hybridization of surface-immobilized single-stranded oligonucleotide on praseodymium oxide (evaluated as a biosensor surface for the first time) with complimentary strands in solution provokes a significant shift of electrical impedance curve. This shift is attributed to a change in electrical characteristics through modification of surface charge of the underlying modified praseodymium oxide upon hybridization with the complementary oligonucelotide strand. On the other hand, using a noncomplementary single strand in solution does not create an equivalent change in the impedance value. This result clearly suggests that a new and simple electrochemical technique based on the change in electrical properties of the modified praseodymium oxide semiconductor surface upon recognition and transduction of a biological event without using labeled species is revealed.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Aim: The aim of this study was to measure the gastrointestinal survival of Lactobacillus casei and its impact on the gut microflora in healthy human volunteers. Methods and Results: Twenty healthy volunteers took part in a double-blind placebo-controlled probiotic feeding study (10 fed probiotic, 10 fed placebo). The probiotic was delivered in two 65 ml aliquots of fermented milk drink (FMD) daily for 21 days at a dose of 8.6 +/- 0.1 Log(10)Lact. casei CFU ml(-1) FMD. Faecal samples were collected before, during and after FMD or placebo consumption, and important groups of faecal bacteria enumerated by fluorescent in situ hybridization (FISH) using oligonucleotide probes targeting the 16S rRNA. The fed Lact. casei was enumerated using selective nutrient agar and colony identity confirmed by pulsed field gel electrophoresis. Seven days after ingestion of FMD, the Lact. casei was recovered from faecal samples taken from the active treatment group at 7.1 +/- 0.4 Log(10) CFU g(-1) faeces (mean +/- SD, n = 9) and numbers were maintained at this level until day 21. Lact. casei persisted in six volunteers until day 28 at 5.0 +/- 0.9 Log(10) CFU g(-1) faeces (mean +/- SD, n = 6). Numbers of faecal lactobacilli increased significantly upon FMD ingestion. In addition, the numbers of bifidobacteria were higher on days 7 and 21 than on days 0 and 28 in both FMD fed and placebo fed groups. Consumption of Lact. casei had little discernible effect on other bacterial groups enumerated. Conclusions: Daily consumption of FMD enabled a probiotic Lact. casei strain to be maintained in the gastrointestinal tract of volunteers at a stable relatively high population level during the probiotic feeding period. Significance and Impact of the Study: The study has confirmed that this probiotic version of Lact. casei survives well within the human gastrointestinal tract.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Exopolysaccharides (EPS) isolated from two Bifidobacterium strains, one of human intestinal origin (Bifidobacterium longum subsp. longum IPLA E44) and the other from dairy origin (Bifidobacterium animalis subsp. lactis IPLA R1), were subjected to in vitro chemically simulated gastrointestinal digestion. which showed the absence of degradation of both polymers in these conditions. Polymers were then used as carbon sources in pH-controlled faecal batch cultures and compared with the non-prebiotic carbohydrate glucose and the prebiotic inulin to determine changes in the composition of faecal bacteria. A set of eight fluorescent in situ hybridisation oligonucleotide probes targeting 16S rRNA sequences was used to quantify specific groups of microorganisms. Growth of the opportunistic pathogen Clostridium histolyticum occurred with all carbohydrates tested similarly to that found in negative control cultures without added carbohydrate and was mainly attributed to the culture conditions used rather than enhancement of growth by these substrates. Polymers E44 and RI stimulated growth of Lactobacillus/Enterococcus, Bifidobacterium, and Bacteroides/Prevotella in a similar way to that seen with inulin. The EPS RI also promoted growth of the Atopobium cluster during the first 24 h of fermentation. An increase in acetic and lactic acids was found during early stages of fermentation (first 10-24 h) correlating with increases of Lactobacillus, Bifidobacterium, and Atopobium. Propionic acid concentrations increased in old cultures, which was coincident with the enrichment of Clostridium cluster IX in cultures with EPS RI and with the increases in Bacteroides in cultures with both microbial EPS (RI and E44) and inulin. The lowest acetic to propionic acid ratio was obtained for EPS E44. None of the carbohydrates tested supported the growth of microorganisms from Clostridium clusters XIVa+b and IV, results that correlate with the poor butyrate production in the presence of EPS. Thus, EPS synthesized by bifidobacteria from dairy and intestinal origins can modulate the intestinal microbiota in vitro, promoting changes in some numerically and metabolically relevant microbial populations and shifts in the production of short chain fatty acids. (C) 2009 Elsevier B.V. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Supplementation of diets with plant extracts such as ginkgo biloba extract (EGb 761®) (definition see editorial) for health and prevention of degenerative diseases is popular. However, it is often difficult to analyse the biological activities of plant extracts due to their complex nature and the possible synergistic and/or antagonistic effects of their components. Genome-wide expression monitoring with high-density oligonucleotide arrays provides one way to examine the molecular targets of plant extracts and may prove a useful tool in evaluating their therapeutic claims. Here, we will briefly describe some of our work on the effect of EGb 761® on differential gene expression in relation to its potential anti-carcinogenic, photoprotective and neuromodulatory properties.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Children with autistic spectrum disorders (ASDs) tend to suffer from severe gastrointestinal problems. Such symptoms may be due to a disruption of the indigenous gut flora promoting the overgrowth of potentially pathogenic micro-organisms. The faecal flora of patients with ASDs was studied and compared with those of two control groups (healthy siblings and unrelated healthy children). Faecal bacterial populations were assessed through the use of a culture-independent technique, fluorescence in situ hybridization, using oligonucleotide probes targeting predominant components of the gut flora. The faecal flora of ASD patients contained a higher incidence of the Clostridium histolyticum group (Clostridium clusters I and 11) of bacteria than that of healthy children. However, the non-autistic sibling group had an intermediate level of the C. histolyticum group, which was not significantly different from either of the other subject groups. Members of the C. histolyticum group are recognized toxin-producers and may contribute towards gut dysfunction, with their metabolic products also exerting systemic effects. Strategies to reduce clostridial population levels harboured by ASD patients or to improve their gut microflora profile through dietary modulation may help to alleviate gut disorders common in such patients.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The recent discovery that vitamin E (VE) regulates gene activity at the transcriptional level indicates that VE may exert part of its biological effects by mechanisms which may be independent of its well-recognised antioxidant function. The objective of this study was the identification of hepatic vitamin E-sensitive genes and examination of the effects of VE on their corresponding biological endpoints. Two groups of male rats were randomly assigned to either a VE-sufficient diet or to a control diet deficient in VE for 290 days. High-density oligonucleotide microarrays comprising over 7000 genes were used to assess the transcriptional response of the liver. Differential gene expression was monitored over a period of 9 months, at four different time-points, and rats were individually profiled. This experimental strategy identified several VE-sensitive genes, which were chronically altered by dietary VE. VE supplementation down-regulated scavenger receptor CD36, coagulation factor IX and 5-alpha-steroid reductase type 1 mRNA levels while hepatic gamma glutamyl-cysteinyl synthetase was significantly up-regulated. Measurement of the corresponding biological endpoints such as activated partial thromboplastin time, plasma dihydrotestosterone and hepatic glutathione substantiated the gene chip data which indicated that dietary VE plays an important role in a range of metabolic processes within the liver. (C) 2004 Elsevier B.V. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Protein kinase C (PKC) plays a pivotal role in modulating the growth of melanocytic cells in culture. We have shown previously that a major physiological substrate of PKC, the 80 kDa myristoylated alanine-rich C-kinase substrate (MARCKS), can be phosphorylated in quiescent, non-tumorigenic melanocytes exposed transiently to a biologically active phorbol ester, but cannot be phosphorylated in phorbol ester-treated, syngeneic malignant melanoma cells. Despite its ubiquitous distribution, the function of MARCKS in cell growth and transformation remains to be demonstrated clearly. We report here that MARCKS mRNA and protein levels are down-regulated significantly in the spontaneously derived murine B16 melanoma cell line compared with syngeneic normal Mel-ab melanocytes. In contrast, the tumourigenic v-Ha-ras-transfonned melan-ocytic line, LTR Ras 2, showed a high basal level of MARCKS phosphorylation which was not enhanced by treatment of cells with phorbol ester. Furthermore, protein levels of MARCKS in LTR Ras 2 cells were similar to those expressed in Mel-ab melanocytes. However, in four out of six murine tumour cell lines investigated, levels of MARCKS protein were barely detectable. Transfection of B16 cells with a plasmid containing the MARCKS cDNA in the sense orientation produced two neomycin-resistant clones displaying reduced proliferative capacity and decreased anchorage-independent growth compared with control cells. In contrast, transfection with the antisense MARCKS construct produced many colonies which displayed enhanced growth and transforming potential compared with control cells. Thus, MARCKS appears to act as a novel growth suppressor in the spontaneous transformation of cells of melanocyte origin and may play a more general role in the tumour progression of other carcinomas.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.