69 resultados para 4-circle X-ray double crystal diffraction


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The reaction of the fulvalene titanium(III) hydride [{Ti(η5-C5H5)(μ-H)}2(μ-η5-η5-C10H8)] (1) with chlorine leads to [{Ti(η5-C5H5)(μ-Cl)}2(μ-η5-η5-C10H8)] (3) and [{Ti(η5-C5H5)Cl2}2(μ-η5-η5-C10H8)] (4). The reaction of 3 with azobenzene, in wet toluene, gives [{Ti(η5-C5H5)Cl}2(μ-O)(μ-η5-η5-C10H8)] (5) and 1,2-diphenyl hydrazine. The alkylation of 4 and the analogous zirconium complex [{Zr(η5-C5H55)Cl2}2(μ-η5-η5-C10H8)] (2) with LiCH2SiMe3 or LiCH3 permits isolation of the tetraalkyl derivatives [{M(η5-C5H5)(CH2SiMe3)2}2(μ-η5-η5-C10H8)] (M  Ti (6); Zr (8)) and [{Ti(η5-C5H5)(CH3)2}2(μ-η5-η5C10H8)] (7). All the new fulvalene compounds were characterized by IR, and 1H and 13C NMR spectroscope, and mass spectra and 5 by X-ray diffraction. The structure of 5 is very similar to that of the comparable TiIV compound [{Ti(η5-C5H5)2Cl}2(μ-O)] except for the smaller TiOTi angle (159.4° against 173.81°) and a significant deviation from linearity.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Phenylphosphinic acid (HPhPO2H) is oxidized to phenylphosphonic acid (PhPO3H2) at room temperature using a solution of [Cu2(μ-O2CCH3)4(H2O)2] in pyridine. The phenylphosphonic acid was recovered as the monomeric copper(II) complex [Cu(PhPO3H)2(C5H5N)4]·H2O (1a), and the reaction thought to proceed via a copper(I) intermediate. Recrystallization of 1a from methanol gave [Cu(PhPO3H)2(C5H5N)4]·2CH3OH (1b). The unsolvated complex [Cu(PhPO3H)2(C5H5N)4] (1c) was prepared by refluxing polymeric [Cu(PhPO3)(H2O)] (2) in pyridine. The X-ray crystal structures of 1b and 1c show that in each of these monomeric complexes the copper(II) ion is ligated by four equatorial pyridine molecules and two axial monoanionic phenylphosphonate groups. A cyclic voltammetric study of 1a revealed a quasi-reversible Cu2+/Cu+ couple with E1/2 = +228 mV (vs Ag/AgCl).

Relevância:

100.00% 100.00%

Publicador:

Resumo:

[Cu2(μO2CCH3)4(H2O)2], [CuCO3·Cu(OH)2], [CoSO4·7H2O], [Co((+)-tartrate)], and [FeSO4·7H2O] react with excess racemic (±)- 1,1′-binaphthyl-2,2′-diyl hydrogen phosphate {(±)-PhosH} to give mononuclear CuII, CoII and FeII products. The cobalt product, [Co(CH3OH)4(H2O)2]((+)-Phos)((−)-Phos) ·2CH3OH·H2O (7), has been identified by X-ray diffraction. The high-spin, octahedral CoII atom is ligated by four equatorial methanol molecules and two axial water molecules. A (+)- and a (−)-Phos− ion are associated with each molecule of the complex but are not coordinated to the metal centre. For the other CoII, CuII and FeII samples of similar formulation to (7) it is also thought that the Phos− ions are not bonded directly to the metal. When some of the CuII and CoII samples are heated under high vacuum there is evidence that the Phos− ions are coordinated directly to the metals in the products.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Treatment of of (R,R)-N,N-salicylidene cyclohexane 1,2-diamine(H(2)L(1)) in methanol with aqueous NH(4)VO(3) solution in perchloric acid medium affords the mononuclear oxovanadium(V) complex [VOL(1)(MeOH)]-ClO(4) (1) as deep blue solid while the treatment of same solution of (R,R)-N,N-salicylidene cyclohexane 1,2-diamine(H(2)L(1)) with aqueous solution of VOSO(4) leads to the formation of di-(mu-oxo) bridged vanadium(V) complex [VO(2)L(2)](2) (2) as green solid where HL(2) = (R,R)-N-salicylidene cyclohexane 1,2-diamine. The ligand HL(2) is generated in situ by the hydrolysis of one of the imine bonds of HL(1) ligand during the course of formation of complex [VO(2)L(2)](2) (2). Both the compounds have been characterized by single crystal X-ray diffraction as well as spectroscopic methods. Compounds 1 and 2 are to act as catalyst for the catalytic bromide oxidation and C-H bond oxidation in presence of hydrogen peroxide. The representative substrates 2,4-dimethoxy benzoic acid and para-hydroxy benzoic acids are brominated in presence of H(2)O(2) and KBr in acid medium using the above compounds as catalyst. The complexes are also used as catalyst for C-H bond activation of the representative hydrocarbons toluene, ethylbenzene and cyclohexane where hydrogen peroxide acts as terminal oxidant. The yield percentage and turnover number are also quite good for the above catalytic reaction. The oxidized products of hydrocarbons have been characterized by GC Analysis while the brominated products have been characterized by (1)H NMR spectroscopic studies.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

In the past two decades, the geometric pathways involved in the transformations between inverse bicontinuous cubic phases in amphiphilic systems have been extensively theoretically modeled. However, little experimental data exists on the cubic-cubic transformation in pure lipid systems. We have used pressure-jump time-resolved X-ray diffraction to investigate the transition between the gyroid Q(II)(G) and double-diamond Q(II)(D) phases in mixtures of 1-monoolein in 30 wt% water. We find for this system that the cubic-cubic transition occurs without any detectable intermediate structures. In addition, we have determined the kinetics of the transition, in both the forward and reverse directions, as a function of pressure-jump amplitude, temperature, and water content. A recently developed model allows (at least in principle) the calculation of the activation energy for lipid phase transitions from such data. The analysis is applicable only if kinetic reproducibility is achieved, at least within one sample, and achievement of such kinetic reproducibility is shown here, by carrying out prolonged pressure-cycling. The rate of transformation shows clear and consistent trends with pressure-jump amplitude, temperature, and water content, all of which are shown to be in agreement with the effect of the shift in the position of the cubic-cubic phase boundary following a change in the thermodynamic parameters.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Acridine-4-carboxamides form a class of known DNA mono-intercalating agents that exhibit cytotoxic activity against tumour cell lines due to their ability to inhibit topoisomerases. Previous studies of bis-acridine derivatives have yielded equivocal results regarding the minimum length of linker necessary between the two acridine chromophores to allow bis-intercalation of duplex DNA. We report here the 1.7 angstrom resolution X-ray crystal structure of a six-carbon-linked bis(acridine-4-carboxamide) ligand bound to d(CGTACG)(2) molecules by non-covalent duplex cross-linking. The asymmetric unit consists of one DNA duplex containing an intercalated acridine-4-carboxamide chromophore at each of the two CG steps. The other half of each ligand is bound to another DNA molecule in a symmetry-related manner, with the alkyl linker threading through the minor grooves. The two crystallographically independent ligand molecules adopt distinct side chain interactions, forming hydrogen bonds to either O6 or N7 on the major groove face of guanine, in contrast to the semi-disordered state of mono-intercalators bound to the same DNA molecule. The complex described here provides the first structural evidence for the non-covalent cross-linking of DNA by a small molecule ligand and suggests a possible explanation for the inconsistent behaviour of six-carbon linked bis-acridines in previous assays of DNA bis-intercalation.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Two octahedral complexes [Ni(HL1)(2)](ClO4)(2) (1) and [Ni(HL2)(2)](ClO4)(2) (2) and a square planar complex [Ni(HL3)]ClO4 (3) have been prepared, where [HL1 = 3-(2-amino-ethylimino)-butan-2-one oxime, HL2 = 3-(2-amino-propylimino)butan-2-one oxime] and H2L3 = 3-[2-(3-hydroxy-1-methyl-but-2-enylideneamino)-1-methyl-ethylimino]-buta n-2-one oxime. All the complexes have been characterized by elemental analyses, spectral studies and room temperature magnetic moment measurements. The molecular structures of all three compounds were elucidated on the basis of X-ray crystallography: complexes 1 and 2 are seen to be the met isomers. (C) 2008 Elsevier Ltd. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Thallium cation complexation by calix[4]tubes has been investigated by a combination of (TI)-T-205, H-1 NMR and ES MS demonstrating the solution formation of a dithallium complex in which the cations are held in the calix[4]arene cavities. In addition, the structure of the complex has been determined in the solid state revealing the cations to be held exclusively by pi-cation interactions. Furthermore, this crystal structure has been used as the basis for molecular dynamics simulations to confirm that binding of the smaller K+ cation in the calix[4]tube cryptand like array occurs via the axial route featuring a g-cation intermediate.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Solvent influences on the crystallization of polymorph and hydrate forms of the nootropic drug piracetam (2-oxo-pyrrolidineacetamide) were investigated from water, methanol, 2-propanol, isobutanol, and nitromethane. Crystal growth profiles of piracetam polymorphs were constructed using time-resolved diffraction snapshots collected for each solvent system. Measurements were performed by in situ energy dispersive X-ray diffraction recorded in Station 16.4 at the synchrotron radiation source (SRS) at Daresbury Laboratory, CCLRC UK. Crystallizations from methanol, 2-propanol, isobutanol, and nitromethane progressed in a similar fashion with the initial formation of form I which then converted relatively quickly to form II with form III being generated upon further cooling. However, considerable differences were observed for the polymorphs lifetime and both the rate and temperature of conversion using the different solvents. The thermodynamically unstable form I was kinetically favored in isobutanol and nitromethane where traces of this polymorph were observed below 10 degrees C. In contrast, the transformation of form II and subsequent growth of form III were inhibited in 2-propanol and nitromethane solutions. Aqueous solutions produced hydrate forms of piracetam which are different from the reported monohydrate; this crystallization evolved through successive generation of transient structures which transformed upon exchange of intramolecular water between the liquid and crystalline phases. (c) 2007 Wiley-Liss, Inc. and the American Pharmacists Association J Pharm Sci 96:1069-1078, 2007.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

WThe capillary flow alignment of the thermotropic liquid crystal 4-n-octyl-4′-cyanobiphenyl in the nematic and smectic phases is investigated using time-resolved synchrotron small-angle x-ray scattering. Samples were cooled from the isotropic phase to erase prior orientation. Upon cooling through the nematic phase under Poiseuille flow in a circular capillary, a transition from the alignment of mesogens along the flow direction to the alignment of layers along the flow direction (mesogens perpendicular to flow) appears to occur continuously at the cooling rate applied. The transition is centered on a temperature at which the Leslie viscosity coefficient α3 changes sign. The configuration with layers aligned along the flow direction is also observed in the smectic phase. The transition in the nematic phase on cooling has previously been ascribed to an aligning-nonaligning or tumbling transition. At high flow rates there is evidence for tumbling around an average alignment of layers along the flow direction. At lower flow rates this orientation is more clearly defined. The layer alignment is ascribed to surface-induced ordering propagating into the bulk of the capillary, an observation supported by the parallel alignment of layers observed for a static sample at low temperatures in the nematic phase.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Two new complex salts of the form (Bu4N)(2)[Ni(L)(2)] (1) and (Ph4P)(2)[Ni(L)(2)] (2) and four heteroleptic complexes cis-M(PPh3)(2)(L) [M = Ni(II) (3), Pd(II) (4), L = 4-CH3OC6H4SO2N=CS2] and cis-M(PPh3)(2)(L') [M = Pd(II) (5), Pt(II) (6), L' = C6H5SO2N=CS2] were prepared and characterized by elemental analyses, IR, H-1, C-13 and P-31 NMR and UV-Vis spectra, solution and solid phase conductivity measurements and X-ray crystallography. A minor product trans-Pd(PPh3)(2)(SH)(2), 4a was also obtained with the synthesis of 4. The NiS4 and MP2S2 core in the complex salts and heteroleptic complexes are in the distorted square-plane whereas in the trans complex, 4a the centrosymmetric PdS2P2 core is perforce square planar. X-ray crystallography revealed the proximity of the ortho phenyl proton of the PPh3 ligand to Pd(II) showing rare intramolecular C-H center dot center dot center dot Pd anagostic binding interactions in the palladium cis-5 and trans-4a complexes. The complex salts with sigma(rt) values similar to 10 (5) S cm (1) show semi-conductor behaviors. The palladium and platinum complexes show photoluminescence properties in solution at room temperature.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A series of hexadentate ligands, H2Lm (m = 1−4), [1H-pyrrol-2-ylmethylene]{2-[2-(2-{[1H-pyrrol-2-ylmethylene]amino}phenoxy)ethoxy]phenyl}amine (H2L1), [1H-pyrrol-2-ylmethylene]{2-[4-(2-{[1H-pyrrol-2-ylmethylene]amino}phenoxy)butoxy]phenyl}amine (H2L2), [1H-pyrrol-2-ylmethylene][2-({2-[(2-{[1H-pyrrol-2-ylmethylene]amino}phenyl)thio]ethyl}thio)phenyl]amine (H2L3) and [1H-pyrrol-2-ylmethylene][2-({4-[(2-{[1H-pyrrol-2-lmethylene]amino}phenyl)thio]butyl}thio) phenyl]amine (H2L4) were prepared by condensation reaction of pyrrol-2-carboxaldehyde with {2-[2-(2-aminophenoxy)ethoxy]phenyl}amine, {2-[4-(2-aminophenoxy)butoxy]phenyl}amine, [2-({2-[(2-aminophenyl)thio]ethyl}thio)phenyl]amine and [2-({4-[(2-aminophenyl)thio]butyl}thio)phenyl]amine respectively. Reaction of these ligands with nickel(II) and copper(II) acetate gave complexes of the form MLm (m = 1−4), and the synthesized ligands and their complexes have been characterized by a variety of physico-chemical techniques. The solid and solution states investigations show that the complexes are neutral. The molecular structures of NiL3 and CuL2, which have been determined by single crystal X-ray diffraction, indicate that the NiL3 complex has a distorted octahedral coordination environment around the metal while the CuL2 complex has a seesaw coordination geometry. DFT calculations were used to analyse the electronic structure and simulation of the electronic absorption spectrum of the CuL2 complex using TDDFT gives results that are consistent with the measured spectroscopic behavior of the complex. Cyclic voltammetry indicates that all copper complexes are electrochemically inactive but the nickel complexes with softer thioethers are more easily oxidized than their oxygen analogs.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

[Et3NH]4[Mo8O26] reacted with MgCl2 giving the triethylammonum magnesium β-octamolybdate(VI) salt [Et3NH]2[Mg(H2O)6Mo8O26]·2H2O (3) and the triethylammonium hydronium β-octaamolybdate(VI) salt [Et3NH]3[(H3O)Mo8O26·2H2O (4), respectively. A small amount of [Et3NH]2[Mo6O269] was formed as a by-product. The salts 3 and 4 were characterized by X-ray crystallography. The [Mg(H2O)6Mo8O26]2− moiety in 3 is polymeric, with each octahedral [Mg(H2O)6]2+ ion sandwiched between two β[Mo8O26]4− ions, being hydrogen bonded to three terminal MOO oxygen atoms on one face of each β[Mo8O26]4− ion. The X-ray crystal structure of 4 corresponds to the reported previously. IR and conductivity data are given for 3 and 4.