Investigation of the prototype silylene reaction, SiH2+H2O(and D2O): time-resolved gas-phase kinetic studies, isotope effects, RRKM calculations, and quantum chemical calculations of the reaction energy surface

Time-resolved kinetic studies of the reaction of silylene, SiH2, with H2O and with D2O have been carried out in the gas phase at 296 and at 339 K, using laser flash photolysis to generate and monitor SiH2. The reaction was studied over the pressure range 10-200 Torr with SF6 as bath gas. The second-order rate constants obtained were pressure dependent, indicating that the reaction is a third-body assisted association process. Rate constants at 339 K were about half those at 296 K. Isotope effects, k(H)/k(D), were small averaging 1.076 0.080, suggesting no involvement of H- (or D-) atom transfer in the rate determining step. RRKM modeling was undertaken based on a transition state appropriate to formation of the expected zwitterionic donoracceptor complex, H2Si...OH2. Because the reaction is close to the low pressure (third order) region, it is difficult to be definitive about the activated complex structure. Various structures were tried, both with and without the incorporation of rotational modes, leading to values for the high-pressure limiting (i.e., true secondorder) rate constant in the range 9.5 x 10(-11) to 5 x 10(-10) cm(3) molecule' s(-1). The RRKM modeling and mechanistic interpretation is supported by ab initio quantum calculations carried out at the G2 and G3 levels. The results are compared and contrasted with the previous studies.

Gas-phase kinetic and theoretical studies of reactions of germylenes and dimethylstannylene

The results of time-resolved gas phase studies of labile germylenes (GeH2 and GeMe2) and dimethylstannylene (SnMe2) reactions reported to date are considered together with data of quantum-chemical investigations of the potential energy surfaces of these systems. Reaction mechanisms are discussed. A comparison of reactivity in the series of carbene analogs, ER2 (E = Si, Ge, Sn, R = H, Me), is made.

Studies on the parallel synthesis and evaluation of new heterocyclic extractants for the partitioning of minor actinides

Multiple parallel synthesis and evaluation have been combined in order to identify new nitrogen heterocycles for the partitioning of minor actinides(III) such as americium(III) from lanthanides such as europium(Ill). An array of triazine-containing molecules was made using multiple parallel syntheses from diketones and amide hydrazides. An excess of each of the resulting purified reagents was dissolved in 1,1,2,2-tetrachloroethane containing 2-bromodecanoic acid, and equilibrated with an aqueous solution containing the radiotracers Eu-152 and Am-241 in nitric acid ([Eu] + [Am] < 400 nanomol dm(-3)). Gamma counting of the organic and aqueous phases led to the identification of several new reagents for the selective extraction of americium(III). In particular, 6-(2-pyridyl)-2-(5,6-dialkyl-1,2,4-triazaphenyl)pyridines were found to be effective reagents for the separation of americium(III) from europium(III), (SFAm/Eu was ca. 30 in [HNO3] = 0.013 mol/L).

Synthesis and cytotoxicity studies of new dimethylamino-functionalised and hetero aryl-substituted titanocene anti-cancer drugs

From the carbolithiation of N,N-dimethylamino fulvene (3a) and different ortho-lithiated heterocycles (furan, thiophene and N-methylpyrrole), the corresponding lithium cyclopentadienide intermediate (4a-c) was formed. These three lithiated intermediates underwent a transmetallation reaction with TiCl4 resulting in dimethylamino-functionalised titanocenes 5a-c. When these titanocenes were tested against LLC-PK cells, the IC50 values obtained were of 240, and 28 mu M for titanocenes 5a and 5b, respectively. The most cytotoxic titanocene 5c with an IC50 value of 5.5 mu M is found to be almost as cytotoxic as cis-platin, which showed an IC50 value of 3.3 mu M, when tested on the LLC-PK cell line, and titanocene 5c is approximately 400 times better than titanocene dichloride itself. (c) 2007 Elsevier B.V. All rights reserved.

Synthesis and cytotoxicity studies of new dimethylamino-functionalised and aryl-substituted titanocene anti-cancer agents

From the carbolithiation of 6-N,N-dimethylamino fulvene (3a) and different lithiated aryl species [p-N,N-dimethylanilinyl lithium, p-anisyl lithium and 4-lithio-benzo[1.3]dioxole (2a-c)], the corresponding lithium cyclopentadienide intermediates 4a-c were formed. These three lithiated intermediates underwent a transmetallation reaction with TiCl4 resulting in dimethylamino-functionalised and aryl-substituted titanocenes 5a-c. When these titanocenes were tested against LLC-PK cells, the IC50 values obtained were of 54, 45 and 26 mu M for titanocenes 5a, b and c, respectively. The most cytotoxic titanocene in this paper, 5c is approximately 10 times less cytotoxic than cis-platin, which showed an IC50 value of 3.3 mu M, when tested on the LLC-PK cell line, but approximately 100 times better than titanocene dichloride. (C) 2007 Elsevier Masson SAS. All rights reserved.

Synthesis and cytotoxicity studies of new dimethylamino-functionalised and indolyl-substituted titanocene anti-cancer drugs

From the carbolithiation of 6-N,N-dimethylamino fulvene (3a) and different ortho-lithiated indole derivatives (5-methoxy-N-methylindole, N-methylindole and N,N-dimethylaminomethylindole), the corresponding lithium cyclopentadienide intermediate (4a-c) was formed. These three lithiated intermediates underwent a transmetallation reaction with TiCl4 resulting in dimethylamino-functionalised titanocenes (5a-c). When these titanocenes were tested against LLC-PK cells, the IC50 values obtained were of 37 and 71 mu M for titanocenes 5a and 5b respectively. The most cytotoxic titanocene in this paper, 5c showed an IC50 value of 8.4 mu M is found to be almost as cytotoxic as cis-platin, which showed an IC50 value of 3.3 mu M, when tested on the LLC-PK cell line, and titanocene 5c is approximately 250 times better than titanocene dichloride itself.

Social interaction deficits and conversational inadequacy in Williams syndrome

Research on social communication skills in individuals with Williams syndrome has been inconclusive, with some arguing that these skills are a relative strength and others that they are a weakness. The aim of the present study was to investigate social interaction abilities in a group of children with WS, and to compare them to a group of children with specific language impairment and a group of typically developing children. Semi-structured conversations were conducted and 100-150 utterances were selected for analysis in terms of exchange structure, turn taking, information transfer and conversational inadequacy. The statistical analyses showed that the children with WS had difficulties with exchange structure and responding appropriately to the interlocutor's requests for information and clarification. They also had significant difficulties with interpreting meaning and providing enough information for the conversational partner. Despite similar language abilities with a group of children with specific language impairment, the children with WS had different social interaction skills, which suggests that they follow an atypical trajectory of development and their neurolinguistic profile does not directly support innate modularity. (c) 2005 Elsevier Ltd. All rights reserved.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Night-time tropospheric chemistry of the unsaturated alcohols (Z)-pent-2-en-1-ol and pent-1-en-3-ol: Kinetic studies of reactions of NO3 and N2O5 with stress-induced plant emissions

The night-time tropospheric chemistry of two stress-induced volatile organic compounds (VOCs), (Z)-pent-2-en-1-ol and pent-1-en-3-ol, has been studied at room temperature. Rate coefficients for reactions of the nitrate radical (NO3) with these pentenols were measured using the discharge-flow technique. Because of the relatively low volatility of these compounds, we employed off-axis continuous-wave cavity-enhanced absorption spectroscopy for detection of NO3 in order to be able to work in pseudo first-order conditions with the pentenols in large excess over NO3. The rate coefficients were determined to be (1.53 +/- 0.23) x 10(-13) and (1.39 +/- 0.19) x 10(-14) cm(3) molecule(-1) s(-1) for reactions of NO3 with (Z)-pent-2-en-1-ol and pent-1-en-3-ol. An attempt to study the kinetics of these reactions with a relative-rate technique, using N2O5 as source of NO3 resulted in significantly higher apparent rate coefficients. Performing relative-rate experiments in known excesses of NO2 allowed us to determine the rate coefficients for the N2O5 reactions to be (5.0 +/- 2.8) x 10(-19) cm(3) molecule(-1) s(-1) for (Z)-pent-2-en-1-ol, and (9.1 +/- 5.8) x 10(-19) cm(3) molecule(-1) s(-1) for pent-1-en-3-ol. We show that these relatively slow reactions can indeed interfere with rate determinations in conventional relative-rate experiments.

Social networks, migration, and care in Tanzania

This paper explores the impacts of the HIV/AIDS epidemic on children and families in northern Tanzania using the concept of social resilience.1 The study is based on the findings of childfocused research with street children and children and families from HIV/AIDS-affected households. The paper illustrates the coping strategies that children and young people, and parents and caregivers adopt at the household level. In particular, it examines how the burden of care affects different generations of women and highlights their resilience, together with the importance of social networks and the fluidity of movement between rural and urban areas. The research suggests that migrating to urban areas to seek a living in the informal sector represents a survival strategy adopted by some children and young people orphaned by AIDS when their families and communities are unable or unwilling to support them. The paper concludes by exploring parents’, caregivers’, children’s, and young people’s views on the forms of social support that would promote their resilience and thereby help to mitigate the impacts of the epidemic at the household level.