224 resultados para single crystal surfaces


Relevância:

80.00% 80.00%

Publicador:

Resumo:

Two styrene-isoprene-styrene block copolymers Vector 4111 and 4113, exhibiting cylindrical (18 wt % PS) and spherical (16 wt % PS) morphology, respectively, have been examined under uniaxial elongation up to 200% strain. On the basis of stress-strain data, mechanical properties are compared for isotropic and oriented polystyrene domains. The structure at various stages of deformation has been determined from SAXS patterns in three planes and two principal deformation directions with respect to orientation. Samples showed a very high degree of hexagonal packing, resulting in an X-ray pattern taken parallel to the cylinder alignment approaching single crystal ordering. Cylinders were aligned with the closest packed planes parallel to film surface. Particular attention has been paid to a lattice deformation process occurring during the first stretching and relaxation cycle. For a copolymer with oriented cylindrical morphology the deformation was affine up to 120% strain. The microdomain spacing was calculated parallel and perpendicular to the stretching direction. The cylindrical microstructure orientation, quantified by Hermans' orientation factor reduced during elongation of oriented polymer, while the elongation of isotropic sample caused an increase of orientation. Deformation of all studied morphologies was reversible.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The phase diagram of cyclopentane has been studied by powder neutron diffraction, providing diffraction patterns for phases I, II, and III, over a range of temperatures and pressures. The putative phase IV was not observed. The structure of the ordered phase III has been solved by single-crystal diffraction. Computational modeling reveals that there are many equienergetic ordered structures for cyclopentane within a small energy range. Molecular dynamics simulations reproduce the structures and diffraction patterns for phases I and III and also show an intermediate disordered phase, which is used to interpret phase II.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Two new silver-antimony sulfides, [C2H9N2][Ag2SbS3] (1) and [C2H9N2](2)[Ag5Sb3S8] (2), have been prepared solvothermally in the presence of ethylenediamine and characterized by single-crystal X-ray diffraction, thermogravimetry, and elemental analysis. Compound 1 crystallizes in the space group Pn (a = 6.1781(1) Angstrom, b =11.9491(3) Angstrom, c = 6.9239(2) Angstrom, =111.164(1)degrees) and 2 in the space group Pm (a = 6.2215(2) Angstrom, b = 15.7707(7) Angstrom, c = 11.6478(5) Angstrom, beta = 92.645(2)degrees). The structure of 1 consists of chains of fused five-membered Ag2SbS2 rings linked to form layers, between which the template molecules reside. Compound 2 contains honeycomb-like sheets of fused silver-antimony-sulfide six-membered rings linked to form double layers. The idealized structure can be considered to be an ordered defect derivative of that of lithium bismuthide, Li3Bi, and represents a new solid-state structure type.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

A new chromium-antimony-sulfide, [Cr(C6H18N4)(SbS3)], has been synthesised under solvothermal conditions from CrCl3. 6H(2)O, Sb2S3 and S in the presence of triethylenetetramine at 433 K and characterised by single-crystal X-ray diffraction, thermogravimetry, elemental analysis and SQUID magnetometry. The structure of [Cr(C6H18N4)(SbS3)] consists of neutral mononuclear chromium-centred complexes, in which the Cr3+ is chelated by one tetradentate triethylenetetramine molecule and a bidentate SbS33- ligand, yielding distorted octahedral coordination. Intermolecular hydrogen bonds link individual molecules into layers within the ac plane. Within a layer, molecules occur in pairs with each member related by a centre of inversion. The Cr...Cr separation within a pair is approximately 6.5 Angstrom. Magnetic susceptibility data reveal Curie-Weiss behaviour with mu(eff) = 3.819(3)/mu(B) and a negligible Weiss constant, indicative of non-interacting Cr3+ ions. (C) 2003 Elsevier Science Ltd. All rights reserved.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Two new antimony sulphides have been prepared solvothermally and characterised by single-crystal X-ray diffraction. [Co(en)(3)][Sb4S7] (1) was prepared at 140 degreesC from COS, Sb2S3 and S in the presence of ethylenediamine, whilst heating a mixture of Sb2S3, Co and S in tris(2aminoethyl)amine, N(CH2CH2NH2)(3), at 180 degreesC fegults in the formation of [C6H20N4][Sb4S7] (2). Both materials contain [Sb4S7](2-) chains formed from linkage of cyclic Sb3S63- units by SbS33- pyramids. In (1), the [Sb4S7] chains are linked by secondary Sb-S interactions to form sheets, between which the. charge balancing [Co(en)(3)](2+) cations reside. The structure of (2) involves interconnection of pairs of [Sb4S7](2-) chains through Sb2S2 rings to form isolated [Sb4S7](2-) double chains which are interleaved by protonated template molecules. (C) 2004 Elsevier B.V. All rights resereved.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The effects of isoelectronic replacement of a neutral nitrogen donor atom by an anionic carbon atom in terpyridine ruthenium(II) complexes on the electronic and photophysical properties of the resulting N,C,N'- and C,N,N'-cyclometalated aryl ruthenium(II) complexes were investigated. To this end, a series of complexes was prepared either with ligands containing exclusively nitrogen donor atoms, that is, [Ru(R-1-tpy)(R-2-tpy)](2+) (R-1, R-2 = H, CO2Et), or bearing either one N,C,N'- or C,N,N'-cyclometalated ligand and one tpy ligand, that is, [Ru(R-1-(NCN)-C-Lambda-N-Lambda)(R-2-tpy)](+) and [Ru(R-1-(CNN)-N-Lambda-N-Lambda)(R-2-tpy)](+), respectively. Single-crystal X-ray structure determinations showed that cyclometalation does not significantly alter the overall geometry of the complexes but does change the bond lengths around the ruthenium(II) center, especially the nitrogen-to-ruthenium bond length trans to the carbanion. Substitution of either of the ligands with electron-withdrawing ester functionalities fine-tuned the electronic properties and resulted in the presence of an IR probe. Using trends obtained from redox potentials, emission energies, IR spectroelectrochemical responses, and the character of the lowest unoccupied molecular orbitals from DFT studies, it is shown that the first reduction process and luminescence are associated with the ester-substituted C,N,N'-cyclometalated ligand in [Ru(EtO2C-(CNN)-N-Lambda-N-Lambda)(tpy)](+). Cyclometalation in an N,C,N'-bonding motif changed the energetic order of the ruthenium d(zx), d(yz), and d(xy) orbitals. The red-shifted absorption in the N,C,N'-cyclometalated complexes is assigned to MLCT transitions to the tpy ligand. The red shift observed upon introduction of the ester moiety is associated with an increase in intensity of low-energy transitions, rather than a red shift of the main transition. Cyclometalation in the C,N,N'-binding motif also red-shifts the absorption, but the corresponding transition is associated with both ligand types. Luminescence of the cyclometalated complexes is relatively independent of the mode of cyclometalation, obeying the energy gap law within each individual series.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Elongated crystalline particles formed as by-products during poly(arylene ether ketone) synthesis by electrophilic precipitation-polycondensation of 4,4'-diphenoxybenzophenone with terephthaloyl chloride or isophthaloyl chloride, thought previously to be polymer-whiskers, have now been identified as macrocyclic phases. Single crystal X-ray analysis of the needle-like particles formed in the reaction with terephthaloyl chloride, using the microdiffraction technique with synchrotron radiation, revealed that they consist of a macrocylic compound containing ten phenylene units, i.e. the [2 + 2] cyclic dimer. An analogous structure has also been demonstrated for the corresponding macrocycle derived from the reaction of 4,4-diphenoxybenzophenone with isophthaloyl chloride. Chloroform extraction of the products of the two polycondensations dissolved the macrocyclic material (but not the linear polymer), and analysis of the extracts by MALDI-TOF mass spectrometry demonstrated the presence in both cases of homologous families of macrocyclic products. Higher yields of macrocycles were obtained under pseudo-high dilution conditions, enabling the [2 + 2] cyclodimers from reactions of 4,4'-diphenoxybenzophenone with both terephthaloyl and isophthaloyl chloride to be isolated as pure compounds and fully characterised. (C) 2003 Published by Elsevier Ltd.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The ligands 1,4,8,11-tetraazacyclotetradecane-1,4,8-triacetic-11-methylphosphonic acid (H(5)te3a1p) and 1,4,8,11-tetraazacyclotetradecane-1,4,8-triacetic acid (H(3)te3a) were synthesized, the former one for the first time. The syntheses of these ligands were achieved from reactions on 1,4,8,11-tetraazacyclotetradecane-1,4,8-tris( carbamoylmethyl) hydroiodide (te3am center dot HI), and compounds (Hte3am)(+), 1, and (H(7)te3a1p)(2+), 4, were characterized by X-ray diffraction. Structures of two other compounds resulting from side-reactions, (H(2)te2lac)(2+), 2, and (H(4)te2a2p(OEt2))(2+), 3, were also determined by X-ray diffraction. Potentiometric titrations of H(5)te3a1p and H(3)te3a were performed at 298.2 K and ionic strength 0.10 mol dm(-3) in NMe4NO3 to determine their protonation constants. H-1 and P-31 NMR titrations of H(5)te3a1p were carried out in order to determine the very high first protonation constant of this ligand and to elucidate the sequence of protonation. Potentiometric studies of the two ligands with Ca2+, Mn2+, Co2+, Ni2+, Cu2+, Zn2+, Cd2+ and Pb2+ metal ions performed in the same experimental conditions showed that the complexes of H5te3a1p present very high thermodynamic stability while complexes of H(3)te3a, particularly Co2+ and Zn2+, are even more stable. P-31 NMR spectra of the cadmium(II) complex of H(5)te3a1p showed that the phosphonate moiety was coordinated to the metal ion. The UV-vis-NIR spectroscopic data and magnetic moment values of Co2+ and Ni2+ complexes of H(5)te3a1p and H(3)te3a together with the EPR of the corresponding Cu2+ complexes indicated that all these complexes adopt distorted octahedral coordination geometries in solution. This was confirmed by the single crystal structure of [Cu-2(Hte3a)(H2O)(3)Cl]Cl-0.5(ClO4)(0.5) center dot 2H(2)O that showed two distorted octahedral copper centres bridged by a N-acetate pendant arm with a Cu center dot center dot center dot Cu distance of 4.890(1) angstrom. The first one is encapsulated into the macrocyclic cavity surrounded by four nitrogen and two oxygen donors from the macrocycle, whereas the second one is on the periphery of the macrocycle and is coordinated to two oxygen atoms of one acetate pendant arm in chelating fashion, one chloride and three water molecules.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The behaviour of the lattice parameters of HTCuCN (high-temperature form), AgCN and AuCN have been investigated as a function of temperature over the temperature range 90–490 K. All materials show one-dimensional negative thermal expansion (NTE) along the ––(M––CN)–– chain direction c (ac(HT-CuCN) ¼32.1 10–6 K1, ac(AgCN)¼23.910–6 K1 and ac(AuCN) ¼9.3106 K1 over the temperature range 90–490 K). The origin of this behaviour has been studied using RMC modelling of Bragg and total neutron diffraction data from AgCN and AuCN at 10 and 300 K. These analyses yield details of the local motions within the chains responsible for NTE. The low-temperature form of CuCN, LT-CuCN, has been studied using single-crystal X-ray diffraction. In this form of CuCN, wavelike distortions of the ––(Cu––CN)–– chains occur in the static structure, which are reminiscent of the motions seen in the RMC modelling of AgCN and AuCN, which are responsible for the NTE behaviour.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Novel macrocyclic receptors which bind electron-donor aromatic substrates via π-stacking donor- acceptor interactions are obtained by cyclo-imidization of an amine-functionalized arylether-sulfone with pyromellitic- and 1,4,5,8-naphthalene-tetracarboxylic dianhydrides. These macrocycles complex with a wide variety of π-donor substrates including tetrathiafulvalene, naphthalene, anthracene, pyrene, perylene, and functional derivatives of these polycyclic hydrocarbons. The resulting supramolecular assemblies range from simple 1:1 complexes, to [2]- and [3]-pseudorotaxanes, and even (as a result of crystallographic disorder) an apparent polyrotaxane. Direct, five-component self-assembly of a metal-centred [3]pseudorotaxane is also observed, on complexation of a macrocyclic ether-imide with 8-hydroxyquinoline in the presence of palladium(II) ions. Binding studies in solution were carried out by 1H NMR and UV-visible spectroscopy, and the stoichiometries of binding were confirmed by Job plots based on charge-transfer absorption bands. The highest association constants are found for strong π-donor guests with large surface-areas, notably perylene and 1-hydroxypyrene, for which Ka values of 1.4 x 103 and 2.3 x 103 M-1 respectively are found. Single crystal X-ray analyses of the receptors and their derived complexes reveal large, induced-fit distortions of the macrocyclic frameworks as a result of complexation. These structures provide compelling evidence for the existence of strong, attractive forces between the electronically-complementary aromatic π-systems of host and guest.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Sequence-specific binding is demonstrated between pyrene-based tweezer molecules and soluble, high molar mass copolyimides. The binding involves complementary pi - pi stacking interactions, polymer chain-folding, and hydrogen bonding and is extremely sensitive to the steric environment around the pyromellitimide binding-site. A detailed picture of the intermolecular interactions involved has been obtained through single-crystal X-ray studies of tweezer complexes with model diimides. Ring-current magnetic shielding of polyimide protons by the pyrene '' arms '' of the tweezer molecule induces large complexation shifts of the corresponding H-1 NMR resonances, enabling specific triplet sequences to be identified by their complexation shifts. Extended comonomer sequences (triplets of triplets in which the monomer residues differ only by the presence or absence of a methyl group) can be '' read '' by a mechanism which involves multiple binding of tweezer molecules to adjacent diimide residues within the copolymer chain. The adjacent-binding model for sequence recognition has been validated by two conceptually different sets of tweezer binding experiments. One approach compares sequence-recognition events for copolyimides having either restricted or unrestricted triple-triplet sequences, and the other makes use of copolymers containing both strongly binding and completely nonbinding diimide residues. In all cases the nature and relative proportions of triple-triplet sequences predicted by the adjacent-binding model are fully consistent with the observed H-1 NMR data.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Epitaxial ultrathin titanium dioxide films of 0.3 to similar to 7 nm thickness on a metal single crystal substrate have been investigated by high resolution vibrational and electron spectroscopies. The data complement previous morphological data provided by scanned probe microscopy and low energy electron diffraction to provide very complete characterization of this system. The thicker films display electronic structure consistent with a stoichiometric TiO2 phase. The thinner films appear nonstoichiometric due to band bending and charge transfer from the metal substrate, while work function measurements also show a marked thickness dependence. The vibrational spectroscopy shows three clear phonon bands at 368, 438, and 829 cm(-1) (at 273 K), which confirms a rutile structure. The phonon band intensity scales linearly with film thickness and shift slightly to lower frequencies with increasing temperature, in accord with results for single crystals. (c) 2007 American Institute of Physics.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

In this article we present for the first time accurate density functional theory (DFT) and time-dependent (TD) DFT data for a series of electronically unsaturated five-coordinate complexes [Mn(CO)(3)(L-2)](-), where L-2 stands for a chelating strong pi-donor ligand represented by catecholate, dithiolate, amidothiolate, reduced alpha-diimine (1,4-dialkyl-1,4-diazabutadiene (R-DAB), 2,2'-bipyridine) and reduced 2,2'-biphosphinine types. The single-crystal X-ray structure of the unusual compound [Na(BPY)][Mn(CO)(3)(BPY)]center dot Et2O and the electronic absorption spectrum of the anion [Mn(CO)(3)(BPY)](-) are new in the literature. The nature of the bidentate ligand determines the bonding in the complexes, which varies between two limiting forms: from completely pi-delocalized diamagnetic {(CO)(3)Mn-L-2}(-) for L-2 = alpha-diimine or biphosphinine, to largely valence-trapped {(CO)(3)Mn-1-L-2(2-)}(-) for L-2(2-) = catecholate, where the formal oxidation states of Mn and L-2 can be assigned. The variable degree of the pi-delocalization in the Mn(L-2) chelate ring is indicated by experimental resonance Raman spectra of [Mn(CO)(3)(L-2)](-) (L-2=3,5-di-tBu-catecholate and iPr-DAB), where accurate assignments of the diagnostically important Raman bands have been aided by vibrational analysis. The L-2 = catecholate type of complexes is known to react with Lewis bases (CO substitution, formation of six-coordinate adducts) while the strongly pi-delocalized complexes are inert. The five-coordinate complexes adopt usually a distorted square pyramidal geometry in the solid state, even though transitions to a trigonal bipyramid are also not rare. The experimental structural data and the corresponding DFT-computed values of bond lengths and angles are in a very good agreement. TD-DFT calculations of electronic absorption spectra of the studied Mn complexes and the strongly pi-delocalized reference compound [Fe(CO)(3)(Me-DAB)] have reproduced qualitatively well the experimental spectra. Analyses of the computed electronic transitions in the visible spectroscopic region show that the lowest-energy absorption band always contains a dominant (in some cases almost exclusive) contribution from a pi(HOMO) -> pi*(LUMO) transition within the MnL2 metallacycle. The character of this optical excitation depends strongly on the composition of the frontier orbitals, varying from a partial L-2 -> Mn charge transfer (LMCT) through a fully delocalized pi(MnL2) -> pi*(MnL2) situation to a mixed (CO)Mn -> L-2 charge transfer (LLCT/MLCT). The latter character is most apparent in the case of the reference complex [Fe(CO)(3)(Me-DAB)]. The higher-lying, usually strongly mixed electronic transitions in the visible absorption region originate in the three lower-lying occupied orbitals, HOMO - 1 to HOMO - 3, with significant metal-d contributions. Assignment of these optical excitations to electronic transitions of a specific type is difficult. A partial LLCT/MLCT character is encountered most frequently. The electronic absorption spectra become more complex when the chelating ligand L-2, such as 2,2'-bipyridine, features two or more closely spaced low-lying empty pi* orbitals.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The dinuclear complex [(tpy)Ru-II(PCP-PCP)Ru-II(tPY)]Cl-2 (bridging PCP-PCP = 3,3',5,5'-tetrakis(diphenylphosphinomethyl)biphenyl, [C6H2(CH2PPh2)(2)-3,5](2)(2-)) was prepared via a transcyclometalation reaction of the bis-pincer ligand [PC(H)P-PC(H)P] and the Ru(II) precursor [Ru(NCN)(tpy)]Cl (NCN = [C6H3(CH2NMe2)(2)-2,6](-)) followed by a reaction with 2,2':6',2 ''-terpyridine (tpy). Electrochemical and spectroscopic properties of [(tpy)Ru-II(PCP-PCP)Ru-II(tPY)]Cl-2 are compared with those of the closely related [(tpy)Ru-II(NCN-NCN)Ru-II(tpy)](PF6)(2) (NCN-NCN = [C6H2(CH2- NMe2)(2)-3,5](2)(2-)) obtained by two-electron reduction of [(tpy)Ru-III(NCN-NCN)Ru-III(tpy)](PF6)(4). The molecular structure of the latter complex has been determined by single-crystal X-ray structure determination. One-electron reduction of [(tpy)Ru-III(NCN-NCN)Ru-III(tpy)](PF6)(4) and one-electron oxidation of [(tpy)Ru-II(PCP-PCP)RUII(tpy)]Cl-2 yielded the mixed-valence species [(tpy)Ru-III(NCN-NCN)RUII(tpy)](3+) and [(tpy)Ru-III(PCP-PCP)RUII(tpy)](3+), respectively. The comproportionation equilibrium constants K-c (900 and 748 for [(tpy)Ru-III(NCN-NCN)Ru-III(tpy)](4+) and [(tpy)Ru-II(PCP-PCP)RUII(tpy)](2+), respectively) determined from cyclic voltammetric data reveal comparable stability of the [Ru-III-Ru-II] state of both complexes. Spectroelectrochemical measurements and near-infrared (NIR) spectroscopy were employed to further characterize the different redox states with special focus on the mixed-valence species and their NIR bands. Analysis of these bands in the framework of Hush theory indicates that the mixed-valence complexes [(tpy)Ru-III(PCP-PCP)RUII(tpy)](3+) and [(tpy)Ru-III(NCN-NCN)RUII(tpy)](3+) belong to strongly coupled borderline Class II/Class III and intrinsically coupled Class III systems, respectively. Preliminary DFT calculations suggest that extensive delocalization of the spin density over the metal centers and the bridging ligand exists. TD-DFT calculations then suggested a substantial MLCT character of the NIR electronic transitions. The results obtained in this study point to a decreased metal-metal electronic interaction accommodated by the double-cyclometalated bis-pincer bridge when strong sigma-donor NMe2 groups are replaced by weak sigma-donor, pi-acceptor PPh2 groups