Crystal and molecular structure of the thioether-analogue of PEEK from X-ray powder data and diffraction-modelling

Analysis of X-ray powder data for the melt-crystallisable aromatic poly(thioether thioether ketone) [-S-Ar-S-Ar-CO-Ar](n), ('PTTK', Ar= 1,4-phenylene), reveals that it adopts a crystal structure very different from that established for its ether-analogue PEEK. Molecular modelling and diffraction-simulation studies of PTTK show that the structure of this polymer is analogous to that of melt-crystallised poly(thioetherketone) [-SAr-CO-Ar](n) in which the carbonyl linkages in symmetry-related chains are aligned anti-parallel to one another. and that these bridging units are crystallographically interchangeable. The final model for the crystal structure of PTTK is thus disordered, in the monoclinic space group 121a (two chains per unit cell), with cell dimensions a = 7.83, b = 6.06, c = 10.35 angstrom, beta = 93.47 degrees. (c) 2005 Elsevier Ltd. All rights reserved.

First structural analysis of a naphthalene-based poly(ether ketone): Crystal and molecular simulation from X-ray powder data and diffraction modeling

Polycondensation of 2,6-dihydroxynaphthalene with 4,4'-bis(4"-fluorobenzoyl)biphenyl affords a novel, semicrystalline poly(ether ketone) with a melting point of 406 degreesC and glass transition temperature (onset) of 168 degreesC. Molecular modeling and diffraction-simulation studies of this polymer, coupled with data from the single-crystal structure of an oligomer model, have enabled the crystal and molecular structure of the polymer to be determined from X-ray powder data. This structure-the first for any naphthalene-containing poly(ether ketone)-is fully ordered, in monoclinic space group P2(1)/b, with two chains per unit cell. Rietveld refinement against the experimental powder data gave a final agreement factor (R-wp) of 6.7%.

The anions [(ZrOH(CO3)3)2]6− and [(ZrOH(C2O4)3)2]6−: single crystal X-ray diffraction studies of the complexes guanidinium zirconium carbonate [(C(NH2)3)3ZrOH(CO3)3·H2O]2 and sodium zirconium oxalate Na6(ZrOH(C2O4)3)2·7H2O

The complex [(C(NH2)3)3ZrOH(CO3)3·H2O]2 (A) has been shown by means of a single crystal X-ray diffraction study to contain [C(NH2)3]+ cations and dimeric anions of formulation [(ZrOH(CO3)3)2]6−. The anion is centrosymmetric with each metal being bonded to two bridging OH groups and three chelating CO2−3 ions. The Zr atoms are thus eight coordinate with a dodecahedral environments. The ZrO distances formed by the bridgng OH groups are shorter than those formed through zirconiu carbonate interactions. The non-bonded Zr…Zr distance is 3.47(2) Å. An infrared spectroscopic investigation of A provides data which support the findings of the crystallographic study. Likewise the complex Na6(ZrOH(CO2O4)3)2·7H2O (B) contains the anion [(ZrOH(C2O4)3)2]6−. This anion is structurally related to the anion in A as each Zr atom has an eight-coordinate dodecahedral environment being bonded to two bridging OH groups and three chelating oxalate ligands, but has no imposed crysallographic symmetry. The Zr…Zr non-bonded distance is 3.50(1) Å. The OZrO bridge angles are 69.7(4)° and A and 67.4(3)° in B.

Preparation and properties of gallaborane, GaBH6: structure of the gaseous molecule H2Ga(μ-H)2BH2 as determined by vibrational, electron diffraction, and ab initio studies, and structure of the crystalline solid at 110 K as determined by x-ray diffraction``

Gallaborane (GaBH6, 1), synthesized by the metathesis of LiBH4 with [H2GaCl]n at ca. 250 K, has been characterized by chemical analysis and by its IR and 1H and 11B NMR spectra. The IR spectrum of the vapor at low pressure implies the presence of only one species, viz. H2Ga(μ-H)2BH2, with a diborane-like structure conforming to C2v symmetry. The structure of this molecule has been determined by gas-phase electron diffraction (GED) measurements afforced by the results of ab initio molecular orbital calculations. Hence the principal distances (rα in Å) and angles ( α in deg) are as follows: r(Ga•••B), 2.197(3); r(Ga−Ht), 1.555(6); r(Ga−Hb), 1.800(6); r(B−Ht), 1.189(7); r(B−Hb), 1.286(7); Hb−Ga−Hb, 71.6(4); and Hb−B−Hb, 110.0(5) (t = terminal, b = bridging). Aggregation of the molecules occurs in the condensed phases. X-ray crystallographic studies of a single crystal at 110 K reveal a polymeric network with helical chains made up of alternating pseudotetrahedral GaH4 and BH4 units linked through single hydrogen bridges; the average Ga•••B distance is now 2.473(7) Å. The compound decomposes in the condensed phases at temperatures exceeding ca. 240 K with the formation of elemental Ga and H2 and B2H6. The reactions with NH3, Me3N, and Me3P are also described.

A pressure-jump time-resolved x-ray diffraction study of cubic-cubic transition kinetics in monoolein

In the past two decades, the geometric pathways involved in the transformations between inverse bicontinuous cubic phases in amphiphilic systems have been extensively theoretically modeled. However, little experimental data exists on the cubic-cubic transformation in pure lipid systems. We have used pressure-jump time-resolved X-ray diffraction to investigate the transition between the gyroid Q(II)(G) and double-diamond Q(II)(D) phases in mixtures of 1-monoolein in 30 wt% water. We find for this system that the cubic-cubic transition occurs without any detectable intermediate structures. In addition, we have determined the kinetics of the transition, in both the forward and reverse directions, as a function of pressure-jump amplitude, temperature, and water content. A recently developed model allows (at least in principle) the calculation of the activation energy for lipid phase transitions from such data. The analysis is applicable only if kinetic reproducibility is achieved, at least within one sample, and achievement of such kinetic reproducibility is shown here, by carrying out prolonged pressure-cycling. The rate of transformation shows clear and consistent trends with pressure-jump amplitude, temperature, and water content, all of which are shown to be in agreement with the effect of the shift in the position of the cubic-cubic phase boundary following a change in the thermodynamic parameters.

Pressure-jump X-ray studies of liquid crystal transitions in lipids

In this paper, we give an overview of our studies by static and time-resolved X-ray diffraction of inverse cubic phases and phase transitions in lipids. In 1, we briefly discuss the lyotropic phase behaviour of lipids, focusing attention on non-lamellar structures, and their geometric/topological relationship to fusion processes in lipid membranes. Possible pathways for transitions between different cubic phases are also outlined. In 2, we discuss the effects of hydrostatic pressure on lipid membranes and lipid phase transitions, and describe how the parameters required to predict the pressure dependence of lipid phase transition temperatures can be conveniently measured. We review some earlier results of inverse bicontinuous cubic phases from our laboratory, showing effects such as pressure-induced formation and swelling. In 3, we describe the technique of pressure-jump synchrotron X-ray diffraction. We present results that have been obtained from the lipid system 1:2 dilauroylphosphatidylcholine/lauric acid for cubic-inverse hexagonal, cubic-cubic and lamellar-cubic transitions. The rate of transition was found to increase with the amplitude of the pressure-jump and with increasing temperature. Evidence for intermediate structures occurring transiently during the transitions was also obtained. In 4, we describe an IDL-based 'AXCESS' software package being developed in our laboratory to permit batch processing and analysis of the large X-ray datasets produced by pressure-jump synchrotron experiments. In 5, we present some recent results on the fluid lamellar-Pn3m cubic phase transition of the single-chain lipid 1-monoelaidin, which we have studied both by pressure-jump and temperature-jump X-ray diffraction. Finally, in 6, we give a few indicators of future directions of this research. We anticipate that the most useful technical advance will be the development of pressure-jump apparatus on the microsecond time-scale, which will involve the use of a stack of piezoelectric pressure actuators. The pressure-jump technique is not restricted to lipid phase transitions, but can be used to study a wide range of soft matter transitions, ranging from protein unfolding and DNA unwinding and transitions, to phase transitions in thermotropic liquid crystals, surfactants and block copolymers.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Fulvalene titanium and zirconium complexes: synthesis and NMR study of phosphanido-, alkyl-, and alkynyl-derivatives. X-ray crystal structures of [{Ti(η5−C5H5)(μ−PPH2)}2{μ−(η5−C5H4−η5−C5H4)}] and [{Zr(η5−C5H5)(μ−C≡CSiMe3)}2{μ−(η5−C5H4−η5−C5H4)}]

Reaction of with one or two equivalents of LiPPh2 afforded the new phosphanidometal(III) complexes . Reaction of 2 with LiC≡CSiMe3 led to the diamagnetic zirconium(III) alkynyl derivative [{Zr(C5H5)(μ−C≡CSiMe3)}2(μ−η5−C5H4−η5−C5H4], 7. Alkylation of 6 with LiCH2CMe2Ph gave [{Zr(η5−C5H5)(CH2CMe2Ph)2}2{μ−(η5−C5H4)}], 8. A detailed NMR study of complexes 3 and 4 allowed the observation of the spectral behaviour of the eight different fulvalene protons through their coupling to the 31P nucleus. The fluxional behaviour of complex 7 was studied by dynamic DNMR, and kinetic parameters for the σ-π-conversion of the alkynyl ligand were determined. The molecular structures of complexes 3 and 7 were determined by X-ray diffraction methods.

Synthesis of water-soluble and ether-soluble tetra-μ-acetatodiruthenium(II,III) complexes and X-ray crystal structure of [Ru2(μ-O2CC6H5)4(C2H5OH)2][Ru2(μ-O2CC6H5)4(HSO4)2]

[Ru2(μ-O2CCH3)4Cl] reacts readily with aqueous Ag2SO4 (2: 1 molar ratio) to give the sulphate salt [Ru2(μ-O2CCH3)4(H2O)2]2(SO4) (1). Addition of NaBPh4 to an aqueous solution of 1 produces the ether-soluble tetraphenylborate salt [Ru2(μ-O2CCH3)4(H2O)2][BPh4] (2). A methanolic solution of 1 reacts with Ba(C6H5CCCO2)2 · H2O to give the tetraacetatemonophenylpropynoate complex [Ru2(μ-O2CCH3)4(O2CCCC6H5)] · H2O (3). The reaction of an ethanolic suspension of [Ru2(μ-O2CC6H5)4Cl] with Ag2SO4 and H2SO4 (2 : 1 : 1 molar ratio) leads to the tetra-μ-benzoatodiruthenium(II,III) double complex salt [Ru2(μ-O2CC6H5)4(C2H5OH)2][Ru2(μ-O2CC6H5)4(HSO4)2] (4). Complex 4 is also obtained by reacting an ethanolic solution of 1 with an excess of benzoic acid in the presence of H2SO4. The X-ray crystal structure of 4 shows it to consist of [Ru2(μ-O2CC6H5)4(C2H5OH)2]+ and [Ru2(μ-O2CC6H5)4(HSO4)2]− ions, which are linked together by hydrogen bonds into an infinite polymeric chain. The RuRu distances in the cation and anion are very similar [2.265(2) and 2.272(2) Å, respectively]. Spectroscopic, magnetic, conductivity and cyclic voltammetry data are given for the complexes.

Fulvalene cyclopentadienyl titanium and zirconium(III) and -(IV) complexes. X-Ray crystal structure of [{Ti(η5-C5H5) Cl}2 (μ-O)(μ-η5-η5-C10H8)]

The reaction of the fulvalene titanium(III) hydride [{Ti(η5-C5H5)(μ-H)}2(μ-η5-η5-C10H8)] (1) with chlorine leads to [{Ti(η5-C5H5)(μ-Cl)}2(μ-η5-η5-C10H8)] (3) and [{Ti(η5-C5H5)Cl2}2(μ-η5-η5-C10H8)] (4). The reaction of 3 with azobenzene, in wet toluene, gives [{Ti(η5-C5H5)Cl}2(μ-O)(μ-η5-η5-C10H8)] (5) and 1,2-diphenyl hydrazine. The alkylation of 4 and the analogous zirconium complex [{Zr(η5-C5H55)Cl2}2(μ-η5-η5-C10H8)] (2) with LiCH2SiMe3 or LiCH3 permits isolation of the tetraalkyl derivatives [{M(η5-C5H5)(CH2SiMe3)2}2(μ-η5-η5-C10H8)] (M  Ti (6); Zr (8)) and [{Ti(η5-C5H5)(CH3)2}2(μ-η5-η5C10H8)] (7). All the new fulvalene compounds were characterized by IR, and 1H and 13C NMR spectroscope, and mass spectra and 5 by X-ray diffraction. The structure of 5 is very similar to that of the comparable TiIV compound [{Ti(η5-C5H5)2Cl}2(μ-O)] except for the smaller TiOTi angle (159.4° against 173.81°) and a significant deviation from linearity.

Peroxidative bromination and oxygenation of organic compounds: synthesis, X-ray crystal structure and catalytic implications of mononuclear and binuclear oxovanadium(V) complexes containing Schiffbase ligands

Treatment of of (R,R)-N,N-salicylidene cyclohexane 1,2-diamine(H(2)L(1)) in methanol with aqueous NH(4)VO(3) solution in perchloric acid medium affords the mononuclear oxovanadium(V) complex [VOL(1)(MeOH)]-ClO(4) (1) as deep blue solid while the treatment of same solution of (R,R)-N,N-salicylidene cyclohexane 1,2-diamine(H(2)L(1)) with aqueous solution of VOSO(4) leads to the formation of di-(mu-oxo) bridged vanadium(V) complex [VO(2)L(2)](2) (2) as green solid where HL(2) = (R,R)-N-salicylidene cyclohexane 1,2-diamine. The ligand HL(2) is generated in situ by the hydrolysis of one of the imine bonds of HL(1) ligand during the course of formation of complex [VO(2)L(2)](2) (2). Both the compounds have been characterized by single crystal X-ray diffraction as well as spectroscopic methods. Compounds 1 and 2 are to act as catalyst for the catalytic bromide oxidation and C-H bond oxidation in presence of hydrogen peroxide. The representative substrates 2,4-dimethoxy benzoic acid and para-hydroxy benzoic acids are brominated in presence of H(2)O(2) and KBr in acid medium using the above compounds as catalyst. The complexes are also used as catalyst for C-H bond activation of the representative hydrocarbons toluene, ethylbenzene and cyclohexane where hydrogen peroxide acts as terminal oxidant. The yield percentage and turnover number are also quite good for the above catalytic reaction. The oxidized products of hydrocarbons have been characterized by GC Analysis while the brominated products have been characterized by (1)H NMR spectroscopic studies.

A synchrotron powder X-ray diffraction study of the skutterudite-related phases AB1.5Te1.5 (A=Co, Rh, Ir; B= Ge, Sn)

X-ray resonant scattering has been exploited to investigate the crystal structure of the AB1.5Te1.5 phases (A = Co, Rh, Ir; B = Ge, Sn). Analysis of the diffraction data reveals that CoGe1.5Te1.5 and ASn1.5Te1.5 adopt a rhombohedral skutterudite-related structure, containing diamond-shape B2Te2 rings, in which the B and Te atoms are ordered and trans to each other. Anion ordering is however incomplete, and with increasing the size of both cations and anions, the degree of anion ordering decreases. By contrast, the diffraction data of IrGe1.5Te1.5 are consistent with an almost statistical distribution of the anions over the available sites, although some ordered domains may be present. The thermoelectric properties of these materials are discussed in the light of these results.

Overproduction, purification and preliminary X-ray diffraction analysis of YncE, an iron-regulated Sec-dependent periplasmic protein from Escherichia coli

The yncE gene of Escherichia coli encodes a predicted periplasmic protein of unknown function. The gene is de-repressed under iron restriction through the action of the global iron regulator Fur. This suggests a role in iron acquisition, which is supported by the presence of the adjacent yncD gene encoding a potential TonB-dependent outer-membrane transporter. Here, the preliminary crystallographic structure of YncE is reported, revealing that it consists of a seven-bladed beta-propeller which resembles the corresponding domain of the `surface-layer protein' of Methanosarcina mazei. A full structure determination is under way in order to provide insight into the function of this protein.

Preliminary X-ray diffraction analysis of YcdB from Escherichia coli: a novel haem-containing and Tat-secreted periplasmic protein with a potential role in iron transport

YcdB is a periplasmic haem-containing protein from Escherichia coli that has a potential role in iron transport. It is currently the only reported haem-containing Tat-secreted substrate. Here, the overexpression, purification, crystallization and structure determination at 2.0 angstrom resolution are reported for the apo form of the protein. The apo-YcdB structure resembles those of members of the haem-dependent peroxidase family and thus confirms that YcdB is also a member of this family. Haem-soaking experiments with preformed apo-YcdB crystals have been optimized to successfully generate haem-containing YcdB crystals that diffract to 2.9 angstrom. Completion of model building and structure refinement are under way.

A deliberate synthesis of a mononuclear trans-dimethoxide complex of ruthenium(III). X-ray crystal structure, electrochemistry and electron paramagnetic resonance

Using bis(3,5-dimethylpyrazol-1-yl) methane as the bidentate N donor ligand L, the yellow compound trans-[(RuL2)-L-III(OMe)(2)]ClO4 center dot CH2Cl2 is synthesized. It is a rare example of a mononuclear dialkoxo complex of Ru(III). It shows a quasireversible Ru(II/III) couple at -0.65 V versus NHE in acetonitrile at a Pt electrode. Its magnetic moment at room temperature corresponds to one unpaired electron. It displays a rhombic EPR spectrum in acetone at 77 K with g = 2.219, 2.062 and 1.855. (C) 2009 Elsevier B. V. All rights reserved.