Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

A Galerkin boundary element method for high frequency scattering by convex polygons

In this paper we consider the problem of time-harmonic acoustic scattering in two dimensions by convex polygons. Standard boundary or finite element methods for acoustic scattering problems have a computational cost that grows at least linearly as a function of the frequency of the incident wave. Here we present a novel Galerkin boundary element method, which uses an approximation space consisting of the products of plane waves with piecewise polynomials supported on a graded mesh, with smaller elements closer to the corners of the polygon. We prove that the best approximation from the approximation space requires a number of degrees of freedom to achieve a prescribed level of accuracy that grows only logarithmically as a function of the frequency. Numerical results demonstrate the same logarithmic dependence on the frequency for the Galerkin method solution. Our boundary element method is a discretization of a well-known second kind combined-layer-potential integral equation. We provide a proof that this equation and its adjoint are well-posed and equivalent to the boundary value problem in a Sobolev space setting for general Lipschitz domains.

The PML for rough surface scattering

In this paper we investigate the use of the perfectly matched layer (PML) to truncate a time harmonic rough surface scattering problem in the direction away from the scatterer. We prove existence and uniqueness of the solution of the truncated problem as well as an error estimate depending on the thickness and composition of the layer. This global error estimate predicts a linear rate of convergence (under some conditions on the relative size of the real and imaginary parts of the PML function) rather than the usual exponential rate. We then consider scattering by a half-space and show that the solution of the PML truncated problem converges globally at most quadratically (up to logarithmic factors), providing support for our general theory. However we also prove exponential convergence on compact subsets. We continue by proposing an iterative correction method for the PML truncated problem and, using our estimate for the PML approximation, prove convergence of this method. Finally we provide some numerical results in 2D.(C) 2008 IMACS. Published by Elsevier B.V. All rights reserved.

Electrospinning atactic polystyrene: A neutron scattering study

Electrospinning is a method used to produce nanoscale to microscale sized polymer fibres. In this study we electrospin 1:1 blends of deuterated and hydrogenated atactic-Polystyrene from N,N-Dimethylformamide for small angle neutron scattering experiments in order to analyse the chain conformation in the electrospun fibres. Small angle neutron scattering was carried out on randomly orientated fibre mats obtained using applied voltages of 10kV-15kV and needle tip to collector distances of 20cm and 30cm. Fibre diameters varied from 3mm - 20mm. Neutron scattering data from fibre samples were compared with bulk samples of the same polymer blend. The scattering data indicates that there are pores and nanovoiding present in the fibres; this was confirmed by scanning electron microscopy. A model that combines the scattering from the pores and the labelled polymer chains was used to extract values for the radius of gyration. The radius of gyration in the fibres is found to vary little with the applied voltage, but varies with the initial solution concentration and fibre diameter. The values for the radius of gyration in the fibres are broadly equivalent to that of the bulk state.

A well-posed integral equation formulation for three-dimensional rough surface scattering

We consider the problem of scattering of time-harmonic acoustic waves by an unbounded sound-soft rough surface. Recently, a Brakhage Werner type integral equation formulation of this problem has been proposed, based on an ansatz as a combined single- and double-layer potential, but replacing the usual fundamental solution of the Helmholtz equation with an appropriate half-space Green's function. Moreover, it has been shown in the three-dimensional case that this integral equation is uniquely solvable in the space L-2 (Gamma) when the scattering surface G does not differ too much from a plane. In this paper, we show that this integral equation is uniquely solvable with no restriction on the surface elevation or slope. Moreover, we construct explicit bounds on the inverse of the associated boundary integral operator, as a function of the wave number, the parameter coupling the single- and double-layer potentials, and the maximum surface slope. These bounds show that the norm of the inverse operator is bounded uniformly in the wave number, kappa, for kappa > 0, if the coupling parameter h is chosen proportional to the wave number. In the case when G is a plane, we show that the choice eta = kappa/2 is nearly optimal in terms of minimizing the condition number.

On integral equation and least squares methods for scattering by diffraction gratings

In this paper we consider the scattering of a plane acoustic or electromagnetic wave by a one-dimensional, periodic rough surface. We restrict the discussion to the case when the boundary is sound soft in the acoustic case, perfectly reflecting with TE polarization in the EM case, so that the total field vanishes on the boundary. We propose a uniquely solvable first kind integral equation formulation of the problem, which amounts to a requirement that the normal derivative of the Green's representation formula for the total field vanish on a horizontal line below the scattering surface. We then discuss the numerical solution by Galerkin's method of this (ill-posed) integral equation. We point out that, with two particular choices of the trial and test spaces, we recover the so-called SC (spectral-coordinate) and SS (spectral-spectral) numerical schemes of DeSanto et al., Waves Random Media, 8, 315-414 1998. We next propose a new Galerkin scheme, a modification of the SS method that we term the SS* method, which is an instance of the well-known dual least squares Galerkin method. We show that the SS* method is always well-defined and is optimally convergent as the size of the approximation space increases. Moreover, we make a connection with the classical least squares method, in which the coefficients in the Rayleigh expansion of the solution are determined by enforcing the boundary condition in a least squares sense, pointing out that the linear system to be solved in the SS* method is identical to that in the least squares method. Using this connection we show that (reflecting the ill-posed nature of the integral equation solved) the condition number of the linear system in the SS* and least squares methods approaches infinity as the approximation space increases in size. We also provide theoretical error bounds on the condition number and on the errors induced in the numerical solution computed as a result of ill-conditioning. Numerical results confirm the convergence of the SS* method and illustrate the ill-conditioning that arises.

Acoustic scattering by mildly rough unbounded surfaces in three dimensions

For a nonlocally perturbed half- space we consider the scattering of time-harmonic acoustic waves. A second kind boundary integral equation formulation is proposed for the sound-soft case, based on a standard ansatz as a combined single-and double-layer potential but replacing the usual fundamental solution of the Helmholtz equation with an appropriate half- space Green's function. Due to the unboundedness of the surface, the integral operators are noncompact. In contrast to the two-dimensional case, the integral operators are also strongly singular, due to the slow decay at infinity of the fundamental solution of the three-dimensional Helmholtz equation. In the case when the surface is sufficiently smooth ( Lyapunov) we show that the integral operators are nevertheless bounded as operators on L-2(Gamma) and on L-2(Gamma G) boolean AND BC(Gamma) and that the operators depend continuously in norm on the wave number and on G. We further show that for mild roughness, i.e., a surface G which does not differ too much from a plane, the boundary integral equation is uniquely solvable in the space L-2(Gamma) boolean AND BC(Gamma) and the scattering problem has a unique solution which satisfies a limiting absorption principle in the case of real wave number.

Approximations to the scattering of water waves by steep topography

A new method is developed for approximating the scattering of linear surface gravity waves on water of varying quiescent depth in two dimensions. A conformal mapping of the fluid domain onto a uniform rectangular strip transforms steep and discontinuous bed profiles into relatively slowly varying, smooth functions in the transformed free-surface condition. By analogy with the mild-slope approach used extensively in unmapped domains, an approximate solution of the transformed problem is sought in the form of a modulated propagating wave which is determined by solving a second-order ordinary differential equation. This can be achieved numerically, but an analytic solution in the form of a rapidly convergent infinite series is also derived and provides simple explicit formulae for the scattered wave amplitudes. Small-amplitude and slow variations in the bedform that are excluded from the mapping procedure are incorporated in the approximation by a straightforward extension of the theory. The error incurred in using the method is established by means of a rigorous numerical investigation and it is found that remarkably accurate estimates of the scattered wave amplitudes are given for a wide range of bedforms and frequencies.

Capillary flow behavior of worm-like micelles studied by small-angle X-ray scattering and small angle light scattering

A novel capillary flow device has been developed and applied to study the orientation of worm-like micelles, among other systems. Small-angle X-ray scattering (SAXS) data from micelles formed by a Pluronic block copolymer in aqueous salt solution provides evidence for the formation of worm-like micelles, which align under flow. A transition from a rod-like form factor to a less persistent conformation is observed under flow. Flow alignment of worm-like micelles formed by the low molar mass amphiphile system cetyl pyridinium chloride+sodium salicylate is studied for comparative purposes. Here, inhomogenous flow at the micron scale is revealed by streaks in the small-angle light scattering pattern perpendicular to the flow direction. Copyright (c) 2006 John Wiley & Sons, Ltd.

Self-assembly in aqueous solution of a modified amyloid beta peptide fragment

The self-assembly in films dried from aqueous solutions of a modified amyloid beta peptide fragment is studied. We focus on sequence A beta(16-20), KLVFF, extended by two alanines at the N-terminus to give AAKLVFF. Self-assembly into twisted ribbon fibrils is observed, as confirmed by transmission electron microscopy (TEM). Dynamic light scattering reveals the semi-flexible nature of the AAKLVFF fibrils, while polarized optical microscopy shows that the peptide fibrils crystallize after an aqueous solution of AAKLVFF is matured over 5 days. The secondary structure of the fibrils is studied by FT-IR, circular dichroism and X-ray diffraction (XRD), which provide evidence for beta-sheet structure in the fibril. From high resolution TEM it is concluded that the average width of an AAKLVFF fibril is (63 +/- 18) nm, indicating that these fibrils comprise beta-sheets with multiple repeats of the unit cell, determined by XRD to have b and c dimensions 1.9 and 4.4 nm with an a axis 0.96 nm, corresponding to twice the peptide backbone spacing in the antiparallel beta-sheet. (C) 2008 Elsevier B.V. All rights reserved.

Wormlike micelle formation and flow alignment of a pluronic block copolymer in aqueous solution

The self-assembly into wormlike micelles of a poly(ethylene oxide)-b-poly(propylene oxide)-b-poly(ethylene oxide) triblock copolymer Pluronic P84 in aqueous salt solution (2 M NaCl) has been studied by rheology, small-angle X-ray and neutron scattering (SAXS/SANS), and light scattering. Measurements of the flow curves by controlled stress rheometry indicated phase separation under flow. SAXS on solutions subjected to capillary flow showed alignment of micelles at intermediate shear rates, although loss of alignment was observed for high shear rates. For dilute solutions, SAXS and static light scattering data on unaligned samples could be superposed over three decades in scattering vector, providing unique information on the wormlike micelle structure over several length scales. SANS data provided information on even shorter length scales, in particular, concerning "blob" scattering from the micelle corona. The data could be modeled based on a system of semiflexible self-avoiding cylinders with a circular cross-section, as described by the wormlike chain model with excluded volume interactions. The micelle structure was compared at two temperatures close to the cloud point (47 degrees C). The micellar radius was found not to vary with temperature in this region, although the contour length increased with increasing temperature, whereas the Kuhn length decreased. These variations result in an increase of the low-concentration radius of gyration with increasing temperature. This was consistent with dynamic light scattering results, and, applying theoretical results from the literature, this is in agreement with an increase in endcap energy due to changes in hydration of the poly(ethylene oxide) blocks as the temperature is increased.

Solution self-assembly of hybrid block copolymers containing poly(ethylene glycol) and amphiphilic beta-strand peptide sequences

The self-assembly in aqueous solution of hybrid block copolymers consisting of amphiphilic β-strand peptide sequences flanked by one or two PEG chains was investigated by means of circular dichroism spectroscopy, small-angle X-ray scattering, and transmission electron microscopy. In comparison with the native peptide sequence, it was found that the peptide secondary structure was stabilized against pH variation in the di-and tri-block copolymers with PEG. Small-angle X-ray scattering indicated the presence of fibrillar structures, the dimensions of which are comparable to the estimated width of a β-strand (with terminal PEG chains in the case of the copolymers). Transmission electron microscopy on selectively stained and dried specimens shows directly the presence of fibrils. It is proposed that these fibrils result from the hierarchical self-assembly of peptide β-strands into helical tapes, which then stack into fibrils.

Nematic and columnar ordering of a PEG-peptide conjugate in aqueous solution

The self-assembly in aqueous solution of a PEG-peptide conjugate is studied by spectroscopy, electron microscopy, rheology and small-angle Xray and neutron scattering (SAXS and SANS). The peptide fragment, FFKLVFF is based on fragment KLVFF of the amyloid beta-peptide, A beta(16-20), extended by two hydrophobic phenylalanine units. This is conjugated to PEG which confers water solubility and leads to distinct self-assembled structures. Small-angle scattering reveals the formation of cylindrical fibrils comprising a peptide core and PEG corona. This constrained structure leads to a model parallel beta-sheet self-assembled structure with a radial arrangement of beta sheets. Oil increasing concentration, successively nematic and hexagonal columnar phases are formed. The flow-induced alignment of both structures was studied in situ by SANS using a Couette cell. Shear-induced alignment is responsible for the shear thinning behaviour observed by dynamic shear rheometry. Incomplete recovery of moduli after cessation of shear is consistent with the observation from SANS of retained orientation in the sample.

Orientational ordering in the nematic phase of a polyethylene glycol-peptide conjugate in aqueous solution

The orientational ordering of the nematic phase of a polyethylene glycol (PEG)-peptide block copolymer in aqueous solution is probed by small-angle neutron scattering (SANS), with the sample subjected to steady shear in a Couette cell. The PEG-peptide conjugate forms fibrils that behave as semiflexible rodlike chains. The orientational order parameters (P) over bar (2) and (P) over bar (4) are obtained by modeling the data using a series expansion approach to the form factor of uniform cylinders. The method used is independent of assumptions on the form of the singlet orientational distribution function. Good agreement with the anisotropic two-dimensional SANS patterns is obtained. The results show shear alignment starting at very low shear rates, and the orientational order parameters reach a plateau at higher shear rates with a pseudologarithmic dependence on shear rate. The most probable distribution functions correspond to fibrils parallel to the flow direction under shear, but a sample at rest shows a bimodal distribution with some of the rodlike peptide fibrils oriented perpendicular to the flow direction.

Interactions of bovine serum albumin with ethylene oxide/butylene oxide copolymers in aqueous solution

The interactions of bovine serum albumin (BSA) with three ethylene oxide/butylene oxide (E/B) copolymers having different block lengths and varying molecular architectures is examined in this study in aqueous solutions. Dynamic light scattering (DLS) indicates the absence of BSA-polymer binding in micellar systems of copolymers with lengthy hydrophilic blocks. On the contrary, stable protein-polyrner aggregates were observed in the case of E18B10 block copolymer. Results from DLS and SAXS suggest the dissociation of E/B copolymer micelles in the presence of protein and the absorption of polymer chains to BSA surface. At high protein loadings, bound BSA adopts a more compact conformation in solution. The secondary structure of the protein remains essentially unaffected even at high polymer concentrations. Raman spectroscopy was used to give insight to the configurations of the bound molecules in concentrated solutions. In the vicinity of the critical gel concentration of E18B10 introduction of BSA can dramatically modify the phase diagram, inducing a gel-sol-gel transition. The overall picture of the interaction diagram of the E18B10-BSA reflects the shrinkage of the suspended particles due to destabilization of micelles induced by BSA and the gelator nature of the globular protein. SAXS and rheology were used to further characterize the structure and flow behavior of the polymer-protein hybrid gels and sols.