22 resultados para Dislocations in crystals


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The terminally protected tripeptide Boc-Ala(1)-Leu(2)-Ala(3)-OMe 1 forms antiparallel hydrogen-bonded dimers of two different conformers in the asymmetric unit and the individual dimers then self-associate to form supramolecular beta-sheet structures in crystals and amyloid-like fibrils in the solid state.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Single crystal X-ray diffraction studies show that the beta-turn structure of tetrapeptide I, Boc-Gly-Phe-Aib-Leu-OMe (Aib: alpha-amino isobutyric acid) self-assembles to a supramolecular helix through intermolecular hydrogen bonding along the crystallographic a axis. By contrast the beta-turn structure of an isomeric tetrapeptide II, Boc-Gly-Leu-Aib-Phe-OMe self-assembles to a supramolecular beta-sheet-like structure via a two-dimensional (a, b axis) intermolecular hydrogen bonding network and pi-pi interactions. FT-IR studies of the peptides revealed that both of them form intermolecularly hydrogen bonded supramolecular structures in the solid state. Field emission scanning electron micrographs (FE-SEM) of the dried fibrous materials of the peptides show different morphologies, non-twisted filaments in case of peptide I and non-twisted filaments and ribbon-like structures in case of peptide II.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This experimental study tests the predictions of the Interface Hypothesis (Sorace, 2011, 2012) using two constructions whose appropriateness depends on monitoring discourse information: Clitic Left Dislocation and Fronted Focus. Clitic Left Dislocation relates a dislocated and clitic-doubled object to an antecedent activated in previous discourse, while Fronted Focus does not relate the fronted constituent to a discourse antecedent. The Interface Hypothesis argues that speakers in language contact situations experience difficulties when they have to integrate syntactic with discourse information. We tested four groups of native speakers on these constructions: Spanish monolinguals, bilinguals with more than 7 years residence in the US, intermediate and advanced proficiency heritage speakers. Our findings suggest that attrition has not set in the adult L2 bilingual speakers, and that the heritage speakers perform similarly to the monolingual and the adult sequential bilingual natives.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Helices and sheets are ubiquitous in nature. However, there are also some examples of self-assembling molecules forming supramolecular helices and sheets in unnatural systems. Unlike supramolecular sheets there are a very few examples of peptide sub-units that can be used to construct supramolecular helical architectures using the backbone hydrogen bonding functionalities of peptides. In this report we describe the design and synthesis of two single turn/bend forming peptides (Boc-Phe-Aib-Ile-OMe 1 and Boc-Ala-Leu-Aib-OMe 2) (Aib: alpha-aminoisobutyric acid) and a series of double-turn forming peptides (Boc-Phe-Aib-IIe-Aib-OMe 3, Boc-Leu-Aib-Gly-Aib-OMe 4 and Boc-gamma-Abu-Aib-Leu-Aib-OMe 5) (gamma-Abu: gamma-aminobutyric acid). It has been found that, in crystals, on self-assembly, single turn/bend forming peptides form either a supramolecular sheet (peptide 1) or a supramolecular helix (peptide 2). unlike self-associating double turn forming peptides, which have only the option of forming supramolecular helical assemblages. (c) 2005 Elsevier Ltd. All rights reserved.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

A series of eight synthetic self-assembling terminally blocked tripeptides have been studied for gelation. Some of them form gels in various aromatic solvents including benzene, toluene, xylene, and chlorobenzene. It has been found that the protecting groups play an important role in the formation of organogels. It has been observed that, if the C-terminal has been changed from methyl ester to ethyl ester the gelation property does not change significantly (keeping the N-terminal protecting group same), while the change of the protecting group from ethyl ester to isopropyl ester completely abolishes the gelation property. Similarly, keeping the identical C-terminal protecting group (methyl ester) the results of the gelation study indicate that the substitution of N-terminal protection Boc-(tert-butyloxycarbonyl) to Cbz-(benzyloxycarbonyl) does change the gelation property insignificantly, while the change from Boc- to pivaloyl (Piv-) or acetyl (Ac-) group completely eliminates the gelation property. Morphological studies of the dried gels of two of the peptides indicate the presence of an entangled nano-fibrillar network that might be responsible for gelation. FTIR studies of the gels demonstrate that an intermolecular hydrogen bonding network is formed during gelation. Results of X-ray powder diffraction studies for these gelator peptides in different states (dried gels, gel, and bulk solids) reflected that the structure in the wet gel is distinctly different from the dried gel and solid state structures. Single crystal X-ray diffraction studies of a non-gelator peptide, which is structurally similar to the gelator molecules reveal that the peptide forms an antiparallel beta-sheet structure in crystals. (c) 2007 Elsevier Ltd. All rights reserved.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Terminally protected acyclic tripeptides containing tyrosine residues at both termini self-assemble into nanotubes in crystals through various non-covalent interactions including intermolecular hydrogen bonds. The nanotube has an average internal diameter of 5 angstrom (0.5 nm) and the tubular ensemble is developed through the hydrogen-bonded phenolic-OH side chains of tyrosine (Tyr) residues [Org. Lett. 2004, 6, 4463]. We have synthesized and studied several tripeptides 3-6 to probe the role of tyrosine residues in nanotube structure formation. These peptides either have only one Tyr residue at N- or C-termini or they have one or two terminally located phenylalanine (Phe) residues. These tripeptides failed to form any kind of nanotubular structure in the solid state. Single crystal X-ray diffraction studies of these peptides 3-6 clearly demonstrate that substitution of any one of the terminal Tyr residues in the Boc-Tyr-X-Tyr-OMe (X=VaI or Ile) sequence disrupts the formation of the nanotubular structure indicating that the presence of two terminally located Tyr residues is vital for nanotube formation. (c) 2006 Elsevier Ltd. All rights reserved.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Terminally protected acyclic tripeptides Boc-Tyr(1)-Val(2)-Tyr(3)-OMe 1 and Boc-Tyr(1)-lle(2)-Tyr(3)-OMe 2 self-assemble into nanotubes in crystals through various noncovalent interactions with an average internal diameter of 5 Angstrom (0.5 nm), and the tubular ensemble is developed through the hydrogen-bonded side chains of tyrosine residues. The inside of the hollow nanotubular structures is hydrophilic; however, no solvent molecules have been crystallographically detected.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

A terminally protected acyclic tetrapeptide Boc-Aib-Val-Aib-beta-Ala-OMe 1 (Aib: alpha-aminoisobutyric acid, beta-Ala: beta-Alanine) self-assembles into a continuous hydrogen-bonded supramolecular helix with an average diameter of 10Angstrom (1nm) starting from a double bend molecular conformation in crystals and further self-assembly of this supramolecular architecture leads to the formation of polydisperse nanorods of diameters 10-40 nm.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Three terminally protected tripeptides Boc-gamma-Abu-Val-Leu-OMe 1, Boc-gamma-Abu-Leu-Phe-OMe 2 and Boc-gamma-Abu-Val-Tyr-OMe 3 (gamma-Abu = gamma-aminobutyric acid) each containing an N-terminally positioned gamma-aminobutyric acid residue have been synthesized, purified and studied. FT-IR studies of all these peptides revealed that these peptides form intermolecularly hydrogen bonded supramolecular beta-sheet structures. Peptides 1, 2 and 3 adopt extended backbone beta-strand molecular structures in crystals. Crystal packing of all these peptides demonstrates that these beta-strand structures self-assemble to form intermolecularly H-bonded parallel beta-sheet structures. Peptide 3 uses a side chain tyrosyl -OH group as an additional hydrogen bonding functionality in addition to the backbone CONH groups to pack in crystals. Transmission electron microscopic studies of all peptides indicate that they self-assemble to form nanofibrillar structures of an average diameter of 65 nm. These peptide fibrils exhibit amyloid-like behavior as they bind to a physiological dye Congo red and show a characteristic green-gold birefringence under polarizing microscope.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The stress relaxation behaviour of two frozen sucrose solutions (7% and 19%) during indentation in the temperature range of -20C to -40C were investigated. The stress relaxation is similar to that of pure polycrystalline ice, which is controlled by steady-state creep. The steady state creep rate exponent, m, of 7% and 19% sucrose solutions lies between 2.3 and 3.6. The steady state creep rate constant, B, of 19% sucrose solution is greater than that of 7% sucrose solution. It is suggested that the steady-state creep rate exponent m depends on contributions from the proportions of favourably oriented grains, unfavourably oriented grains and grain boundaries to creep and that these components depend on the value of internal stress which is related to the hardness of samples at the different testing temperatures. The steady-state creep rate constant B depends on the mobility of dislocations in sucrose solutions which, in turn, depends on the temperature and the concentration of sucrose.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Encyclopedia entry on "dislocations" in language

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Reactions in (molecular) organic crystalline solids have been shown to be important for exerting control that is unattainable over chemical transformations in solution. Such control has also been achieved for reactions within metal– organic cages. In these examples, the reactants are already in place within the crystals following the original crystal growth. The post-synthetic modification of metal–organic frameworks (MOFs and indeed reactions and catalysis within MOFs have been recently demonstrated; in these cases the reactants enter the crystals through permanent channels. Another growing area of interest within molecular solid-state chemistry is synthesis by mechanical co-grinding of solid reactants—often referred to as mechanochemistry. Finally, in a small number of reported examples, molecules also have been shown to enter nonporous crystals directly from the gas or vapor phase, but in only a few of these examples does a change in covalent bonding result, which indicates that a reaction occurs within the nonporous crystals. It is this latter type of highly uncommon reaction that is the focus of the present study.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The physical and empirical relationships used by microphysics schemes to control the rate at which vapor is transferred to ice crystals growing in supercooled clouds are compared with laboratory data to evaluate the realism of various model formulations. Ice crystal growth rates predicted from capacitance theory are compared with measurements from three independent laboratory studies. When the growth is diffusion- limited, the predicted growth rates are consistent with the measured values to within about 20% in 14 of the experiments analyzed, over the temperature range −2.5° to −22°C. Only two experiments showed significant disagreement with theory (growth rate overestimated by about 30%–40% at −3.7° and −10.6°C). Growth predictions using various ventilation factor parameterizations were also calculated and compared with supercooled wind tunnel data. It was found that neither of the standard parameterizations used for ventilation adequately described both needle and dendrite growth; however, by choosing habit-specific ventilation factors from previous numerical work it was possible to match the experimental data in both regimes. The relationships between crystal mass, capacitance, and fall velocity were investigated based on the laboratory data. It was found that for a given crystal size the capacitance was significantly overestimated by two of the microphysics schemes considered here, yet for a given crystal mass the growth rate was underestimated by those same schemes because of unrealistic mass/size assumptions. The fall speed for a given capacitance (controlling the residence time of a crystal in the supercooled layer relative to its effectiveness as a vapor sink, and the relative importance of ventilation effects) was found to be overpredicted by all the schemes in which fallout is permitted, implying that the modeled crystals reside for too short a time within the cloud layer and that the parameterized ventilation effect is too strong.