23 resultados para Defects in crystals
Resumo:
Point defects in metal oxides such as TiO2 are key to their applications in numerous technologies. The investigation of thermally induced nonstoichiometry in TiO2 is complicated by the difficulties in preparing and determining a desired degree of nonstoichiometry. We study controlled self-doping of TiO2 by adsorption of 1/8 and 1/16 monolayer Ti at the (110) surface using a combination of experimental and computational approaches to unravel the details of the adsorption process and the oxidation state of Ti. Upon adsorption of Ti, x-ray and ultraviolet photoemission spectroscopy (XPS and UPS) show formation of reduced Ti. Comparison of pure density functional theory (DFT) with experiment shows that pure DFT provides an inconsistent description of the electronic structure. To surmount this difficulty, we apply DFT corrected for on-site Coulomb interaction (DFT+U) to describe reduced Ti ions. The optimal value of U is 3 eV, determined from comparison of the computed Ti 3d electronic density of states with the UPS data. DFT+U and UPS show the appearance of a Ti 3d adsorbate-induced state at 1.3 eV above the valence band and 1.0 eV below the conduction band. The computations show that the adsorbed Ti atom is oxidized to Ti2+ and a fivefold coordinated surface Ti atom is reduced to Ti3+, while the remaining electron is distributed among other surface Ti atoms. The UPS data are best fitted with reduced Ti2+ and Ti3+ ions. These results demonstrate that the complexity of doped metal oxides is best understood with a combination of experiment and appropriate computations.
Resumo:
The terminally protected tripeptide Boc-Ala(1)-Leu(2)-Ala(3)-OMe 1 forms antiparallel hydrogen-bonded dimers of two different conformers in the asymmetric unit and the individual dimers then self-associate to form supramolecular beta-sheet structures in crystals and amyloid-like fibrils in the solid state.
Resumo:
Single crystal X-ray diffraction studies show that the beta-turn structure of tetrapeptide I, Boc-Gly-Phe-Aib-Leu-OMe (Aib: alpha-amino isobutyric acid) self-assembles to a supramolecular helix through intermolecular hydrogen bonding along the crystallographic a axis. By contrast the beta-turn structure of an isomeric tetrapeptide II, Boc-Gly-Leu-Aib-Phe-OMe self-assembles to a supramolecular beta-sheet-like structure via a two-dimensional (a, b axis) intermolecular hydrogen bonding network and pi-pi interactions. FT-IR studies of the peptides revealed that both of them form intermolecularly hydrogen bonded supramolecular structures in the solid state. Field emission scanning electron micrographs (FE-SEM) of the dried fibrous materials of the peptides show different morphologies, non-twisted filaments in case of peptide I and non-twisted filaments and ribbon-like structures in case of peptide II.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
It is known that terraces at the air-polymer interface of lamella forming diblock copolymers do not make discontinuous jumps in height. Despite the underlying discretized structure, the height profiles are smoothly varying. The width of a transition region of a terrace edge in isolation is typically several hundreds of nanometres, resulting from a balance between surface tension, chain stretching penalties, and the enthalpy of mixing. What is less well known in these systems is what happens when two transition regions interact with one another. In this study, we investigate the dynamics of the interactions between copolymer lamellar edges. We find that the data can be well described by a model that assumes a repulsion between adjacent edges. While the model is simplistic, and does not include molecular level details, its agreement with the data suggest that some of the the underlying assumptions provide insight into the complex interplay between defects.
Resumo:
House builders play a key role in controlling the quality of new homes in the UK. The UK house building sector is, however, currently facing pressures to expand supply as well as conform to tougher low carbon planning and Building Regulation requirements; primarily in the areas of sustainability. There is growing evidence that the pressure the UK house building industry is currently under may be eroding build quality and causing an increase in defects. It is found that the prevailing defect literature is limited to the causes, pathology and statistical analysis of defects (and failures). The literature does not extend to examine how house builders individually and collectively, in practice, collect and learn from defects experience in order to reduce the prevalence of defects in future homes. The theoretical lens for the research is organisational learning. This paper contributes to our understanding of organisational learning in construction through a synthesis of current literature. Further, a suitable organisational learning model is adopted. The paper concludes by reporting the research design of an ongoing collaborative action research project with the National House Building Council (NHBC), focused on developing a better understanding of house builders’ localised defects analysis procedures and learning processes.
Resumo:
Rapid growth in the production of new homes in the UK is putting build quality under pressure as evidenced by an increase in the number of defects. Housing associations (HAs) contribute approximately 20% of the UK’s new housing supply. HAs are currently experiencing central government funding cuts and rental revenue reductions. As part of HAs’ quest to ramp up supply despite tight budget conditions, they are reviewing how they learn from defects. Learning from defects is argued as a means of reducing the persistent defect problem within the UK housebuilding industry, yet how HAs learn from defects is under-researched. The aim of this research is to better understand how HAs, in practice, learn from past defects to reduce the prevalence of defects in future new homes. The theoretical lens for this research is organizational learning. The results drawn from 12 HA case studies indicate that effective organizational learning has the potential to reduce defects within the housing sector. The results further identify that HAs are restricting their learning to focus primarily on reducing defects through product and system adaptations. Focusing on product and system adaptations alone suppresses HAs’ abilities to reduce defects in the future.
Resumo:
Helices and sheets are ubiquitous in nature. However, there are also some examples of self-assembling molecules forming supramolecular helices and sheets in unnatural systems. Unlike supramolecular sheets there are a very few examples of peptide sub-units that can be used to construct supramolecular helical architectures using the backbone hydrogen bonding functionalities of peptides. In this report we describe the design and synthesis of two single turn/bend forming peptides (Boc-Phe-Aib-Ile-OMe 1 and Boc-Ala-Leu-Aib-OMe 2) (Aib: alpha-aminoisobutyric acid) and a series of double-turn forming peptides (Boc-Phe-Aib-IIe-Aib-OMe 3, Boc-Leu-Aib-Gly-Aib-OMe 4 and Boc-gamma-Abu-Aib-Leu-Aib-OMe 5) (gamma-Abu: gamma-aminobutyric acid). It has been found that, in crystals, on self-assembly, single turn/bend forming peptides form either a supramolecular sheet (peptide 1) or a supramolecular helix (peptide 2). unlike self-associating double turn forming peptides, which have only the option of forming supramolecular helical assemblages. (c) 2005 Elsevier Ltd. All rights reserved.
Resumo:
A series of eight synthetic self-assembling terminally blocked tripeptides have been studied for gelation. Some of them form gels in various aromatic solvents including benzene, toluene, xylene, and chlorobenzene. It has been found that the protecting groups play an important role in the formation of organogels. It has been observed that, if the C-terminal has been changed from methyl ester to ethyl ester the gelation property does not change significantly (keeping the N-terminal protecting group same), while the change of the protecting group from ethyl ester to isopropyl ester completely abolishes the gelation property. Similarly, keeping the identical C-terminal protecting group (methyl ester) the results of the gelation study indicate that the substitution of N-terminal protection Boc-(tert-butyloxycarbonyl) to Cbz-(benzyloxycarbonyl) does change the gelation property insignificantly, while the change from Boc- to pivaloyl (Piv-) or acetyl (Ac-) group completely eliminates the gelation property. Morphological studies of the dried gels of two of the peptides indicate the presence of an entangled nano-fibrillar network that might be responsible for gelation. FTIR studies of the gels demonstrate that an intermolecular hydrogen bonding network is formed during gelation. Results of X-ray powder diffraction studies for these gelator peptides in different states (dried gels, gel, and bulk solids) reflected that the structure in the wet gel is distinctly different from the dried gel and solid state structures. Single crystal X-ray diffraction studies of a non-gelator peptide, which is structurally similar to the gelator molecules reveal that the peptide forms an antiparallel beta-sheet structure in crystals. (c) 2007 Elsevier Ltd. All rights reserved.
Resumo:
Terminally protected acyclic tripeptides containing tyrosine residues at both termini self-assemble into nanotubes in crystals through various non-covalent interactions including intermolecular hydrogen bonds. The nanotube has an average internal diameter of 5 angstrom (0.5 nm) and the tubular ensemble is developed through the hydrogen-bonded phenolic-OH side chains of tyrosine (Tyr) residues [Org. Lett. 2004, 6, 4463]. We have synthesized and studied several tripeptides 3-6 to probe the role of tyrosine residues in nanotube structure formation. These peptides either have only one Tyr residue at N- or C-termini or they have one or two terminally located phenylalanine (Phe) residues. These tripeptides failed to form any kind of nanotubular structure in the solid state. Single crystal X-ray diffraction studies of these peptides 3-6 clearly demonstrate that substitution of any one of the terminal Tyr residues in the Boc-Tyr-X-Tyr-OMe (X=VaI or Ile) sequence disrupts the formation of the nanotubular structure indicating that the presence of two terminally located Tyr residues is vital for nanotube formation. (c) 2006 Elsevier Ltd. All rights reserved.
Resumo:
Terminally protected acyclic tripeptides Boc-Tyr(1)-Val(2)-Tyr(3)-OMe 1 and Boc-Tyr(1)-lle(2)-Tyr(3)-OMe 2 self-assemble into nanotubes in crystals through various noncovalent interactions with an average internal diameter of 5 Angstrom (0.5 nm), and the tubular ensemble is developed through the hydrogen-bonded side chains of tyrosine residues. The inside of the hollow nanotubular structures is hydrophilic; however, no solvent molecules have been crystallographically detected.
Resumo:
Ulcerative colitis (UC) is characterized by impairment of the epithelial barrier and the formation of ulcer-type lesions, which result in local leaks and generalized alterations of mucosal tight junctions. Ultimately, this results in increased basal permeability. Although disruption of the epithelial barrier in the gut is a hallmark of inflammatory bowel disease and intestinal infections, it remains unclear whether barrier breakdown is an initiating event of UC or rather a consequence of an underlying inflammation, evidenced by increased production of proinflammatory cytokines. UC is less common in smokers, suggesting that the nicotine in cigarettes may ameliorate disease severity. The mechanism behind this therapeutic effect is still not fully understood, and indeed it remains unclear if nicotine is the true protective agent in cigarettes. Nicotine is metabolized in the body into a variety of metabolites and can also be degraded to form various breakdown products. It is possible these metabolites or degradation products may be the true protective or curative agents. A greater understanding of the pharmacodynamics and kinetics of nicotine in relation to the immune system and enhanced knowledge of out permeability defects in UC are required to establish the exact protective nature of nicotine and its metabolites in UC. This review suggests possible hypotheses for the protective mechanism of nicotine in UC, highlighting the relationship between gut permeability and inflammation, and indicates where in the pathogenesis of the disease nicotine may mediate its effect.
Resumo:
Two polymorphs of the molecular complex formed between 3-fluorobenzoic acid with 4-acetylpyridine are described and found to be based upon the same dimeric supramolecular construct. The conformational freedom around the hydrogen bond results in a 180 degrees rotation about this intermolecular link, distinguishing the polymorphs and affecting the packing of the dimeric units. The two polymorphs are fully characterised by single crystal X-ray and neutron diffraction and quantum mechanical calculations. There is evidence of structured crystal growth defects in both polymorphic crystals via observation of diffuse scattering and a disorder model for the average structure of Form I, which can be interpreted as a mixing of the two dimer conformations. The similarity of energy of the distinct dimeric units, supporting their likely co-existence, has been verified by periodic quantum chemical calculations.
Resumo:
Protein disulfide isomerase (PDI) derived from intravascular cells is required for thrombus formation. However, it remains unclear whether platelet PDI contributes to the process. Using platelet-specific PDI-deficient mice, we demonstrate that PDI-null platelets have defects in aggregation and ATP secretion induced by thrombin, collagen, and ADP. Such defects were rescued by exogenously-added wild-type but not mutant PDI, indicating that the isomerase activity of platelet surface PDI is critical for the regulatory effect. PDI-deficient platelets expressed increased levels of intracellular ERp57 and ERp72. Platelet PDI regulated αIIbβ3 integrin activation but not P-selectin exposure, Ca2+ mobilization, β3-talin interaction, and platelet spreading on immobilized fibrinogen. Inhibition of ERp57 further diminished αIIbβ3 integrin activation, aggregation and ATP secretion of activated PDI-deficient platelets, suggesting distinct roles of PDI and ERp57 in platelet functions. We found that platelet PDI is important for thrombus formation on collagen-coated surfaces under arteriolar shear. Intravital microscopy demonstrates that platelet PDI is important for platelet accumulation but not initial adhesion and fibrin generation following laser-induced arteriolar injury. Tail bleeding time and blood loss in platelet-specific PDI-deficient mice were not significantly increased. Our results provide important evidence that platelet PDI is essential for thrombus formation but not for hemostasis in mice.