Calcium is essential for the structural integrity of the cysteine-rich, ligand-binding repeat of the low-density lipoprotein receptor

Seven cysteine-rich repeats form the ligand-binding region of the low-density lipoprotein (LDL) receptor. Each of these repeats is assumed to bind a calcium ion, which is needed for association of the receptor with its ligands, LDL and beta-VLDL. The effects of metal ions on the folding of the reduced N-terminal cysteine-rich repeat have been examined by using reverse-phase high-performance liquid chromatography to follow the formation of fully oxidized isomers with different disulfide connectivities. in the absence of calcium many of the 15 possible isomers formed on oxidation, whereas in its presence the predominant product at equilibrium had the native disulfide bond connectivities. Other metals were far less effective at directing disulfide bond formation: Mn2+ partly mimicked the action of Ca2+, but Ba2+, Sr2+, and Mg2+ had little effect. This metal-ion specificity was also observed in two-dimensional H-1 NMR spectral studies: only Ca2+ induced the native three-dimensional fold. The two paramagnetic ions, Gd3+ and Mn2+, and Cd2+ did not promote adoption of a well-defined structure, and the two paramagnetic ions did not displace calcium ions. The location of calcium ion binding sites in the repeat was also explored by NMR spectroscopy. The absence of chemical shift changes for the side chain proton resonances of Asp26, Asp36, and Glu37 from pH 3.9 to 6.8 in the presence of calcium ions and their proximal location in the NMR structures implicated these side chains as calcium ligands. Deuterium exchange NMR experiments also revealed a network of hydrogen bonds that stabilizes the putative calcium-binding loop.

FRA10B structure reveals common elements in repeat expansion and chromosomal fragile site genesis

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

The common tetratricopeptide repeat acceptor site for steroid receptor-associated immunophilins and Hop is located in the dimerization domain of hsp90

Structurally related tetratricopeptide repeat motifs in steroid receptor-associated immunophilins and the STI1 homolog, Hop, mediate the interaction with a common cellular target, hsp90, We have identified the binding domain in hsp90 for cyclophilin 40 (CyP40) using a two-hybrid system screen of a mouse cDNA library. All isolated clones encoded the intact carboxyl terminus of hsp90 and overlapped with a common region corresponding to amino acids 558-724 of murine hsp84, The interaction was confirmed in vitro with bacterially expressed CyP40 and deletion mutants of hsp90 beta and was delineated further to a 124-residue COOH-terminal segment of hsp90, Deletion of the conserved MEEVD sequence at the extreme carboxyl terminus of hsp90 precludes interaction with CyP40, signifying an important role for this motif in hsp90 function. We show that CyP40 and Hop display similar interaction profiles with hsp90 truncation mutants and present evidence for the direct competition of Hop and FK506-binding protein 52 with CyP40 for binding to the hsp90 COOH-terminal region. Our results are consistent with a common tetratricopeptide repeat interaction site for Hop and steroid receptor associated immunophilins within a discrete COOH-terminal domain of hsp90. This region of hsp90 mediates ATP-independent chaperone activity, overlaps the hsp90 dimerization domain, and includes structural elements important for steroid receptor interaction.

A reproducible method for automated extraction of brain volumes from 3D human head MR images

An automated method for extracting brain volumes from three commonly acquired three-dimensional (3D) MR images (proton density, T1 weighted, and T2-weighted) of the human head is described. The procedure is divided into four levels: preprocessing, segmentation, scalp removal, and postprocessing. A user-provided reference point is the sole operator-dependent input required, The method's parameters were first optimized and then fixed and applied to 30 repeat data sets from 15 normal older adult subjects to investigate its reproducibility. Percent differences between total brain volumes (TBVs) for the subjects' repeated data sets ranged from .5% to 2.2%. We conclude that the method is both robust and reproducible and has the potential for wide application.

Structure of a putative ancestral protein encoded by a single sequence repeat from a multidomain proteinase inhibitor gene from Nicotiana alata

Background: The ornamental tobacco Nicotiana alata produces a series of proteinase inhibitors (Pls) that are derived from a 43 kDa precursor protein, NaProPl. NaProPl contains six highly homologous repeats that fold to generate six separate structural domains, each corresponding to one of the native Pls. An unusual feature of NaProPl is that the structural domains lie across adjacent repeats and that the sixth Pl domain is generated from fragments of the first and sixth repeats. Although the homology of the repeats suggests that they may have arisen from gene duplication, the observed folding does not appear to support this. This study of the solution structure of a single NaProPl repeat (aPl1) forms a basis for unravelling the mechanism by which this protein may have evolved, Results: The three-dimensional structure of aPl1 closely resembles the triple-stranded antiparallel beta sheet observed in each of the native Pls. The five-residue sequence Glu-Glu-Lys-Lys-Asn, which forms the linker between the six structural domains in NaProPl, exists as a disordered loop in aPl1. The presence of this loop in aPl1 results in a loss of the characteristically flat and disc-like topography of the native inhibitors. Conclusions: A single repeat from NaProPl is capable of folding into a compact globular domain that displays native-like Pl activity. Consequently, it is possible that a similar single-domain inhibitor represents the ancestral protein from which NaProPl evolved.

A rapid selection/amplification procedure for high-level expression of recombinant protein in a metal-amplifiable mammalian expression system

We describe a strategy for the selection and amplification of foreign gene expression in Chinese hamster ovary (CHO) cells employing a metallothionein gene-containing expression vector. This report describes an amplification procedure that results in an enrichment of clones exhibiting high levels of recombinant protein production and reduces the labour required for screening recombinant cell lines.

Is there an association between normal cognitive functioning and trinucleotide repeat expansion at loci involved in neurodegenerative disorders?

Recent reports have shown neurodegenerative disorders to be associated with abnormal expansions of a CAG trinucleotide repeat allele at various autosomal loci. While normal chromosomes have 14 to 44 repeats, disease chromosomes may have 60 to 84 repeats. The number of CAG repeats on mutant chromosomes correlates with increasing severity of disease or decreasing age at onset of symptoms. Since we are interested in identifying the many quantitative trait loci (QTL) influencing brain functioning, we examined the possibility that the number of CAG repeats in the normal size range at these loci are relevant to "normal" neural functioning. We have used 150 pairs of adolescent (aged 16 years) twins and their parents to examine allele size at the MJD, SCA1, and DRPLA loci in heterozygous normal individuals. These are part of a large ongoing project using cognitive and physiological measures to investigate the genetie influences on cognition, and an extensive protocol of tests is employed to assess some of the key components of intellectual functioning. This study selected to examine full-scale psychometric IQ (FSIQ) and a measure of information processing (choice reaction time) and working memory (slow wave amplitude). CAG repeat size was determined on an ABI Genescan system following multiplex PCR amplification. Quantitative genetic analyses were performed to determine QTL effects of MJD, SCA1, and DRPLA on cognitive functioning. Analyses are in progress and will be discussed.

Estimating HIV incidence rates from age prevalence data in epidemic situations

We present a method of estimating HIV incidence rates in epidemic situations from data on age-specific prevalence and changes in the overall prevalence over time. The method is applied to women attending antenatal clinics in Hlabisa, a rural district of KwaZulu/Natal, South Africa, where transmission of HIV is overwhelmingly through heterosexual contact. A model which gives age-specific prevalence rates in the presence of a progressing epidemic is fitted to prevalence data for 1998 using maximum likelihood methods and used to derive the age-specific incidence. Error estimates are obtained using a Monte Carlo procedure. Although the method is quite general some simplifying assumptions are made concerning the form of the risk function and sensitivity analyses are performed to explore the importance of these assumptions. The analysis shows that in 1998 the annual incidence of infection per susceptible woman increased from 5.4 per cent (3.3-8.5 per cent; here and elsewhere ranges give 95 per cent confidence limits) at age 15 years to 24.5 per cent (20.6-29.1 per cent) at age 22 years and declined to 1.3 per cent (0.5-2.9 per cent) at age 50 years; standardized to a uniform age distribution, the overall incidence per susceptible woman aged 15 to 59 was 11.4 per cent (10.0-13.1 per cent); per women in the population it was 8.4 per cent (7.3-9.5 per cent). Standardized to the age distribution of the female population the average incidence per woman was 9.6 per cent (8.4-11.0 per cent); standardized to the age distribution of women attending antenatal clinics, it was 11.3 per cent (9.8-13.3 per cent). The estimated incidence depends on the values used for the epidemic growth rate and the AIDS related mortality. To ensure that, for this population, errors in these two parameters change the age specific estimates of the annual incidence by less than the standard deviation of the estimates of the age specific incidence, the AIDS related mortality should be known to within +/-50 per cent and the epidemic growth rate to within +/-25 per cent, both of which conditions are met. In the absence of cohort studies to measure the incidence of HIV infection directly, useful estimates of the age-specific incidence can be obtained from cross-sectional, age-specific prevalence data and repeat cross-sectional data on the overall prevalence of HIV infection. Several assumptions were made because of the lack of data but sensitivity analyses show that they are unlikely to affect the overall estimates significantly. These estimates are important in assessing the magnitude of the public health problem, for designing vaccine trials and for evaluating the impact of interventions. Copyright (C) 2001 John Wiley & Sons, Ltd.

Folate-sensitive fragile site FRA10A is due to an expansion of a CGG repeat in a novel gene, FRA10AC1, encoding a nuclear protein

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Modeling the optical constants of solids using acceptance-probability-controlled simulated annealing with an adaptive move generation procedure

The acceptance-probability-controlled simulated annealing with an adaptive move generation procedure, an optimization technique derived from the simulated annealing algorithm, is presented. The adaptive move generation procedure was compared against the random move generation procedure on seven multiminima test functions, as well as on the synthetic data, resembling the optical constants of a metal. In all cases the algorithm proved to have faster convergence and superior escaping from local minima. This algorithm was then applied to fit the model dielectric function to data for platinum and aluminum.