25 resultados para nail dystrophy
em University of Queensland eSpace - Australia
Resumo:
Specific point mutations in caveolin-3, a predominantly muscle-specific member of the caveolin family, have been implicated in limb-girdle muscular dystrophy and in rippling muscle disease. We examined the effect of these mutations on caveolin-3 localization and function. Using two independent assay systems, Raf activation in fibroblasts and neurite extension in PC12 cells, we show that one of the caveolin-3 point mutants, caveolin-3-C71W, specifically inhibits signaling by activated H-Ras but not by K-Ras. To gain insights into the effect of the mutant protein on H-Ras signaling, we examined the localization of the mutant proteins in fibroblastic cells and in differentiating myotubes. Unlike the previously characterized caveolin-3-DGV mutant, the inhibitory caveolin-3-C71W mutant reached the plasma membrane and colocalized with wild type caveolins. In BHK cells, caveolin-3-C71W associated with caveolae and in differentiating muscle cells with the developing T-tubule system. In contrast, the caveolin-3-P104L mutant accumulated in the Golgi complex and had no effect on H-Ras-mediated Raf activation. Inhibition by caveolin-3-C71W was rescued by cholesterol addition, suggesting that the mutant protein perturbs cholesterol-rich raft domains. Thus, we have demonstrated that a naturally occurring caveolin-3 mutation can inhibit signaling involving cholesterol-sensitive raft domains.
Resumo:
Duchenne muscular dystrophy (DMD) is a progressive neuromuscular disease with death usually occurring because of respiratory failure. Signs of early respiratory insufficiency are usually first detectable in sleep. Objective: To study the presentation of sleep-related breathing disorder (SRBD) in patients with DMD. Method:> A retrospective review of patients with DMD attending a tertiary paediatric sleep disorder clinic over a 5-year period. Symptoms, lung function and polysomnographic indices were reviewed. Results: A total of 34 patients with DMD were referred for respiratory assessment (1-15 years). Twenty-two (64%) reported sleep-related symptomatology. Forced vital capacity (FVC) was between 12 and 107% predicted (n = 29). Thirty-two progressed to have polysomnography of which 15 were normal studies (median age: 10 years) and 10 (31%) were diagnostic of obstructive sleep apnoea (OSA) (median age: 8 years). A total of 11 patients (32%) showed hypoventilation (median age: 13 years) during the 5-year period and non-invasive ventilation (NIV) was offered to them. The median FVC of this group was 27% predicted. There was a significant improvement in the apnoea/hypopnoea index (AHI) (mean difference = 11.31, 95% CI = 5.91-16.70, P = 0.001) following the institution of NIV. Conclusions: The prevalence of SRBD in DMD is significant. There is a bimodal presentation of SRBD, with OSA found in the first decade and hypoventilation more commonly seen at the beginning of the second decade. Polysomnography is recommended in children with symptoms of OSA, or at the stage of becoming wheelchair-bound. In patients with the early stages of respiratory failure, assessment with polysomnography-identified sleep hypoventilation and assisted in initiating NIV.
Resumo:
A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.
Resumo:
The analysis of keratin 6 expression is complicated by the presence of multiple isoforms that are expressed constitutively in a number of internal stratified epithelia, in palmoplantar epidermis, and in the companion cell layer of the hair follicle. In addition, keratin 6 expression is inducible in interfollicular epidermis and the outer root sheath of the follicle, in response to wounding stimuli, phorbol esters, or retinoic acid. In order to establish the critical regions involved in the regulation of keratin 6a (the dominant isoform in mice), we generated transgenic mice with two different-sized mouse keratin 6a constructs containing either 1.3 kb or 0.12 kb of 5' flanking sequence linked to the lacZ reporter gene. Both constructs also contained the first intron and the 3' flanking sequence of mouse keratin 6a. Ectopic expression of either transgene was not observed. Double-label immunofluorescence analyses demonstrated expression of the reporter gene in keratin 6 expressing tissues, including the hair follicle, tongue, footpad, and nail bed, showing that both transgenes retained keratinocyte-specific expression. Quantitative analysis of beta -galactosidase activity verified that both the 1.3 and 0.12 kb keratin 6a promoter constructs produced similar levels of the reporter. Notably, both constructs were constitutively expressed in the outer root sheath and interfollicular epidermis in the absence of any activating stimulus, suggesting that they lack the regulatory elements that normally silence transcription in these cells. This study has revealed that a keratin 6a minigene contains critical cis elements that mediate tissue-specific expression and that the elements regulating keratin 6 induction lie distal to the 1.3 kb promoter region.
Resumo:
Duchenne muscular dystrophy (DMD) is a fatal neuromuscular condition affecting approximately one in 3500 live male births resulting from the lack of the myocyte protein dystrophin. The absence of dystrophin in cardiac myocytes is associated with calcium overload which in turn activates calcium-dependent proteolytic enzymes contributing to congestive heart failure, muscle necrosis and fibrosis. To date, the basis for the calcium overload has not been determined. Since L-type calcium channels are a major mediator of calcium influx we determined their potential contribution to the calcium overload. Male muscular dystrophy (mdx) mice and control C57BL10ScSn (C57) mice aged 12– 16 weeks were used in all experiments. In tissue bath studies, isolated contracting left atria from mdx revealed a reduced potency to the dihydropyridine (DHP) agonist BayK8644 and antagonist nifedipine (P < 0.05). Similarly, radioligand binding studies using the DHP antagonist [3H]-PN 200-110 showed a reduced potency (P < 0.05) in isolated membranes, associated with an increased receptor density (P < 0.05). The increased receptor density was supported by RT-PCR experiments revealing increased RNAfor the DHP receptor. Patch clamp studies revealed the presence of a diltiazem sensitive calcium current that showed delayed inactivation in isolated mdx myocytes (P < 0.01). In conclusion, the increased number of DHP binding sites and the delay in L-type current inactivation may both contribute to increased calcium influx and hence calcium overload in the dystrophin deficient mdx cardiac myocytes.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
This study examined the impact of computer and assistive device use on the employment status and vocational modes of people with physical disabilities in Australia. A survey was distributed to people over 15 years in age with physical disabilities living in the Brisbane area. Responses were received from 82 people, including those with spinal cord injuries, cerebral palsy and muscular dystrophy. Of respondents 46 were employed, 22 were unemployed, and 12 were either students or undertaking voluntary work. Three-quarters of respondents used a computer in their occupations, while 15 used assistive devices. Using logistic regression analysis it was found that gender, education, level of computer skill and computer training were significant predictors of employment outcomes. Neither the age of respondent nor use of assistive software were significant predictors. From information obtained in this study guidelines for a training programme designed to maximize the employability of people with physical disabilities were developed.
Resumo:
The plasma membrane of differentiated skeletal muscle fibers comprises the sarcolemma, the transverse (T) tubule network, and the neuromuscular and muscle-tendon junctions. We analyzed the organization of these domains in relation to defined surface markers, beta -dystroglycan, dystrophin, and caveolin-3, These markers were shown to exhibit highly organized arrays along the length of the fiber. Caveolin-3 and beta -dystroglycan/dystrophin showed distinct, but to some extent overlapping, labeling patterns and both markers left transverse tubule openings clear. This labeling pattern revealed microdomains over the entire plasma membrane with the exception of the neuromuscular and muscle-tendon junctions which formed distinct demarcated macrodomains. Our results suggest that the entire plasma membrane of mature muscle comprises a mosaic of T tubule domains together with sareolemmal caveolae and beta -dystroglycan domains. The domains identified with these markers were examined with respect to targeting of viral proteins and other expressed domain-specific markers, We found that each marker protein was targeted to distinct microdomains, The macrodomains were intensely labeled with all our markers. Replacing the cytoplasmic tail of the vesicular stomatitis virus glycoprotein with that of CD4 resulted in retargeting from one domain to another. The domain-specific protein distribution at the muscle cell surface may be generated by targeting pathways requiring specific sorting information but this trafficking is different from the conventional apical-basolateral division. (C) 2001 Academic Press.
Resumo:
Mental retardation and epilepsy often occur together. They are both heterogeneous conditions with acquired and genetic causes. Where causes are primarily genetic, major advances have been made in unraveling their molecular basis. The human X chromosome alone is estimated to harbor more than 100 genes that, when mutated, cause mental retardation(1). At least eight autosomal genes involved in idiopathic epilepsy have been identified(2), and many more have been implicated in conditions where epilepsy is a feature. We have identified mutations in an X chromosome-linked, Aristaless-related, homeobox gene (ARX), in nine families with mental retardation (syndromic and nonspecific), various forms of epilepsy, including infantile spasms and myoclonic seizures, and dystonia. Two recurrent mutations, present in seven families, result in expansion of polyalanine tracts of the ARX protein. These probably cause protein aggregation, similar to other polyalanine(3) and polyglutamine(4) disorders. In addition, we have identified a missense mutation within the ARX homeodomain and a truncation mutation. Thus, it would seem that mutation of ARX is a major contributor to X-linked mental retardation and epilepsy.
Resumo:
Almost 50 years after the first sighting of small pits that covered the surface of mammalian cells, investigators are now getting to grips with the detailed workings of these enigmatic structures that we now know as caveolae.