The human melanocortin-1 receptor locus: analysis of transcription unit, locus polymorphism and haplotype evolution

The complete sequence of the MCIR locus has been assembled, the coding region of the gene is intronless and placed within a 12 kb region flanked by the NULP1 and TUBB4 genes. The immediate promoter region has an E-box site with homology to the M-box consensus known to bind the microphthalmia transcription factor (MITF), however, promoter deletion analysis and transactivation studies have failed to show activation through this element by MITF. Polymorphism within the coding region, immediate 5' promoter region and a variable number tandem repeat (VNTR) minisatellite within the locus have been examined in a collection of Caucasian families and African individuals. Haplotype analysis shows linkage disequilibrium between the VNTR and MCIR coding region red hair variant alleles which can be used to estimate the age of these missense changes. Assuming a mean VNTR mutation rate of 1% and a star phylogeny, we estimate the Arg151Cys variant arose 7500 years before the present day, suggesting these variants may have arisen in the Caucasian population more recently than previously thought. (C) 2001 Published by Elsevier Science B.V.

The serotonin transporter gene and Parkinson's disease

Dysfunction in the serotonin (5-hydroxytryptamine) system and reduced serotonin concentrations have been reported in patients with Parkinson's disease (PD). Serotonin concentrations in neural tissue are controlled by a presynaptic serotonin transporter protein that is encoded by a single gene. Therefore, we investigated whether a polymorphic region in the serotonin transporter gene is associated with PD. Three variable-number tandem repeat (VNTR) elements of the serotonin transporter gene were detected by polymerase chain reaction, those with 9, 10, 11 and 12 copies of the repeat element. The 10-copy VNTR element was significantly less common in patients with PD than controls in the univariate analysis (p < 0.05). Logistic regression analysis revealed no significant differences between patients (n = 198) and controls (n = 200) in the distribution frequencies of 9-and 12-copy alleles and combined genotypes (odds ratio = 1.20; p = 1.71). A positive family history of PD was a strong predictor of disease risk (odds ratio = 2.98; 95% confidence interval 1.51-5.87; p = 0.001). Although slight differences were observed between patient and control groups, these data suggest that defects in serotonin concentrations in patients with PD are unlikely to be due to polymorphisms in the serotonin transporter gene in this large Australian cohort; however, the inverse association observed with the 10-copy allele warrants further investigation. Copyright (C) 2000 S. Karger AG, Basel.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

A multiple account framework for cost-benefit analysis

The paper presents a spreadsheet-based multiple account framework for cost-benefit analysis which incorporates all the usual concerns of cost-benefit analysts such as shadow-pricing to account for market failure. distribution of net benefits. sensitivity and risk analysis, cost of public funds, and environmental effects. The approach is generalizable to a wide range of projects and situations and offers a number of advantages to both analysts and decision-makers, including transparency, a check on internal consistency, and a detailed summary of project net benefits disaggregated by stakeholder group. Of particular importance is the ease with which this framework allows for a project to be evaluated from alternative decision-making perspectives and under alternative policy scenarios where the trade-offs among the project's stakeholders can readily be identified and quantified. (C) 2004 Elsevier Ltd. All rights reserved.

Low frequency of CHEK2 1100delC allele in Australian multiple-case breast cancer families: functional analysis in heterozygous individuals

A protein-truncating variant of CHEK2, 1100delC, is associated with a moderate increase in breast cancer risk. We have determined the prevalence of this allele in index cases from 300 Australian multiple-case breast cancer families, 95% of which had been found to be negative for mutations in BRCA1 and BRCA2. Only two (0.6%) index cases heterozygous for the CHEK2 mutation were identified. All available relatives in these two families were genotyped, but there was no evidence of co-segregation between the CHEK2 variant and breast cancer. Lymphoblastoid cell lines established from a heterozygous carrier contained approximately 20% of the CHEK2 1100delC mRNA relative to wild-type CHEK2 transcript. However, no truncated CHK2 protein was detectable. Analyses of expression and phosphorylation of wild-type CHK2 suggest that the variant is likely to act by haploinsufficiency. Analysis of CDC25A degradation, a downstream target of CHK2, suggests that some compensation occurs to allow normal degradation of CDC25A. Such compensation of the 1100delC defect in CHEK2 might explain the rather low breast cancer risk associated with the CHEK2 variant, compared to that associated with truncating mutations in BRCA1 or BRCA2.

Effects of dopamine receptor D4 variation on alcohol and tobacco use and on novelty seeking: Multivariate linkage and association analysis

The dopamine D4 receptor gene contains a polymorphic sequence consisting of a variable number of 48-base-pair (bp) repeats, and there have been a number of reports that this polymorphism is associated with variation in novelty seeking or in substance abuse and addictive behaviors. In this study we have assessed the linkage and association of DRD4 genotype with novelty seeking, alcohol use, and smoking in a sample of 377 dizygotic twin pairs and 15 single twins recruited from the Australian Twin Registry (ATR). We found no evidence of linkage or association of the DRD4 locus with any of the phenotypes. We made use of repeated measures for some phenotypes to increase power by multivariate genetic analysis, but allelic effects were still non-significant. Specifically, it has been suggested that the DRD4 7-repeat allele is associated with increased novelty seeking in males but we found no evidence for this, despite considerable power to do so. We conclude that DRD4 variation does not have an effect on use of alcohol and the problems that arise from it, on smoking, or on novelty seeking behavior. (C) 2003 Wiley-Liss, Inc.

The phasevarion: A genetic system controlling coordinated, random switching of expression of multiple genes

Several host-adapted bacterial pathogens contain methyltransferases associated with type III restriction-modification (R-M) systems that are subject to reversible, high-frequency on/off switching of expression (phase variation). To investigate the role of phase-variable expression of R-M systems, we made a mutant strain lacking the methyltransferase (mod) associated with a type III R-M system of Haemophilus influenzae and analyzed its phenotype. By microarray analysis, we identified a number of genes that were either up- or down-regulated in the mod mutant strain. This system reports the coordinated random switching of a set of genes in a bacterial pathogen and may represent a widely used mechanism.

Evidence for a QTL on chromosome 19 influencing LDL cholesterol levels in the general population

The genetic basis of cardiovascular disease (CVD) with its complex etiology is still largely elusive. Plasma levels of lipids and apolipoproteins are among the major quantitative risk factors for CVD and are well-established intermediate traits that may be more accessible to genetic dissection than clinical CVD end points. Chromosome 19 harbors multiple genes that have been suggested to play a role in lipid metabolism and previous studies indicated the presence of a quantitative trait locus (QTL) for cholesterol levels in genetic isolates. To establish the relevance of genetic variation at chromosome 19 for plasma levels of lipids and apolipoproteins in the general, out-bred Caucasian population, we performed a linkage study in four independent samples, including adolescent Dutch twins and adult Dutch, Swedish and Australian twins totaling 493 dizygotic twin pairs. The average spacing of short-tandem-repeat markers was 6 - 8 cM. In the three adult twin samples, we found consistent evidence for linkage of chromosome 19 with LDL cholesterol levels ( maximum LOD scores of 4.5, 1.7 and 2.1 in the Dutch, Swedish and Australian sample, respectively); no indication for linkage was observed in the adolescent Dutch twin sample. The QTL effects in the three adult samples were not significantly different and a simultaneous analysis of the samples increased the maximum LOD score to 5.7 at 60 cM pter. Bivariate analyses indicated that the putative LDL-C QTL also contributed to the variance in ApoB levels, consistent with the high genetic correlation between these phenotypes. Our study provides strong evidence for the presence of a QTL on chromosome 19 with a major effect on LDL-C plasma levels in outbred Caucasian populations.

Use of the EM algorithm to detect QTL affecting multiple-traits in an across half-sib family analysis

QTL detection experiments in livestock species commonly use the half-sib design. Each male is mated to a number of females, each female producing a limited number of progeny. Analysis consists of attempting to detect associations between phenotype and genotype measured on the progeny. When family sizes are limiting experimenters may wish to incorporate as much information as possible into a single analysis. However, combining information across sires is problematic because of incomplete linkage disequilibrium between the markers and the QTL in the population. This study describes formulae for obtaining MLEs via the expectation maximization (EM) algorithm for use in a multiple-trait, multiple-family analysis. A model specifying a QTL with only two alleles, and a common within sire error variance is assumed. Compared to single-family analyses, power can be improved up to fourfold with multi-family analyses. The accuracy and precision of QTL location estimates are also substantially improved. With small family sizes, the multi-family, multi-trait analyses reduce substantially, but not totally remove, biases in QTL effect estimates. In situations where multiple QTL alleles are segregating the multi-family analysis will average out the effects of the different QTL alleles.

Association between dopamine transporter (DATI) genotype, left-sided inattention, and an enhanced response to methylphenidate in attention-deficit hyperactivity disorder

A polymorphism of the dopamine transporter gene (DAT1, 10-repeat) is associated with attention-deficit hyperactivity disorder (ADHD) and has been linked to an enhanced response to methylphenidate (MPH). One aspect of the attention deficit in ADHD includes a subtle inattention to left space, resembling that seen after right cerebral hemisphere damage. Since left-sided inattention in ADHD may resolve when treated with MPH, we asked whether left-sided inattention in ADHD was related to DAT1 genotype and the therapeutic efficacy of MPH. A total of 43 ADHD children and their parents were genotyped for the DAT1 30 variable number of tandem repeats polymorphism. The children performed the Landmark Test, a well-validated measure yielding a spatial attentional asymmetry index ( leftward to rightward attentional bias). Parents rated their child's response to MPH retrospectively using a three-point scale ( no, mediocre or very good response). Additionally, parents used a symptom checklist to rate behavior while on and off medication. A within-family control design determined whether asymmetry indices predicted biased transmission of 10-repeat parental DAT1 alleles and/or response to MPH. It was found that left-sided inattention predicted transmission of the 10-repeat allele from parents to probands and was associated with the severity of ADHD symptomatology. Children rated as achieving a very good response to MPH displayed left-sided inattention, while those rated as achieving a poorer response did not. Our results suggest a subgroup of children with ADHD for whom the 10-repeat DAT1 allele is associated with left-sided inattention. MPH may be most efficacious in this group because it ameliorates a DAT1-mediated hypodopaminergic state.

Conserved modularity and potential for alternate splicing in mouse and human Slit genes

The vertebrate Slit gene family currently consists of three members;Slit1,Slit2 and Slit3. Each gene encodes a protein containing multiple epidermal growth factor and leucine rich repeat motifs, which are likely to have importance in cell-cell interactions. In this study, we sought to fully define and characterise the vertebrate Slit gene family. Using long distance PCR coupled with in silico mapping, we determined the genomic structure of all three Slit genes in mouse and man. Analysis of EST and genomic databases revealed no evidence of further Slit family members in either organism. All three Slit genes were encoded by 36 (Slit3) or 37 (Slit1 and Slit2) exons covering at least 143 kb or 183 kb of mouse or human genomic DNA respectively. Two additional potential leucine-rich repeat encoding exons were identified within intron 12 of Slit2. These could be inserted in frame, suggesting that alternate splicing may occur in Slit2 A search for STS sequences within human Slit3 anchored this gene to D5S2075 at the 5' end (exon 4) and SGC32449 within the 3' UTR, suggesting that Slit3 may cover greater than 693 kb. The genomic structure of all Slit genes demonstrated considerable modularity in the placement of exon-intron boundaries such that individual leucine-rich repeat motifs were encoded by individual 72 by exons. This further implies the potential generation of multiple Slit protein isoforms varying in their number of repeat units. cDNA library screening and EST database searching verified that such alternate splicing does occur.

Recommendations for animal DNA forensic and identity testing

Genetic analysis in animals has been used for many applications, such as kinship analysis, for determining the sire of an offspring when a female has been exposed to multiple males, determining parentage when an animal switches offspring with another dam, extended lineage reconstruction, estimating inbreeding, identification in breed registries, and speciation. It now also is being used increasingly to characterize animal materials in forensic cases. As such, it is important to operate under a set of minimum guidelines that assures that all service providers have a template to follow for quality practices. None have been delineated for animal genetic identity testing. Based on the model for human DNA forensic analyses, a basic discussion of the issues and guidelines is provided for animal testing to include analytical practices, data evaluation, nomenclature, allele designation, statistics, validation, proficiency testing, lineage markers, casework files, and reporting. These should provide a basis for professional societies and/or working groups to establish more formalized recommendations.

Genomewide Linkage Scan of 409 European-ancestry and African American Families with Schizophrenia: Suggestive Evidence of Linkage at 8p23.3-p21.2 and 11p13.1-q14.1 in the Combined Sample

We report the clinical characteristics of a schizophrenia sample of 409 pedigrees-263 of European ancestry ( EA) and 146 of African American ancestry ( AA)-together with the results of a genome scan ( with a simple tandem repeat polymorphism interval of 9 cM) and follow-up fine mapping. A family was required to have a proband with schizophrenia ( SZ) and one or more siblings of the proband with SZ or schizoaffective disorder. Linkage analyses included 403 independent full-sibling affected sibling pairs ( ASPs) ( 279 EA and 124 AA) and 100 all-possible half-sibling ASPs ( 15 EA and 85 AA). Nonparametric multipoint linkage analysis of all families detected two regions with suggestive evidence of linkage at 8p23.3-q12 and 11p11.2-q22.3 ( empirical Z likelihood-ratio score [ Z(lr)] threshold >= 2.65) and, in exploratory analyses, two other regions at 4p16.1-p15.32 in AA families and at 5p14.3-q11.2 in EA families. The most significant linkage peak was in chromosome 8p; its signal was mainly driven by the EA families. Z(lr) scores >= 2.0 in 8p were observed from 30.7 cM to 61.7 cM ( Center for Inherited Disease Research map locations). The maximum evidence in the full sample was a multipoint Z(lr) of 3.25 ( equivalent Kong-Cox LOD of 2.30) near D8S1771 ( at 52 cM); there appeared to be two peaks, both telomeric to neuregulin 1 ( NRG1). There is a paracentric inversion common in EA individuals within this region, the effect of which on the linkage evidence remains unknown in this and in other previously analyzed samples. Fine mapping of 8p did not significantly alter the significance or length of the peak. We also performed fine mapping of 4p16.3-p15.2, 5p15.2-q13.3, 10p15.3-p14, 10q25.3-q26.3, and 11p13-q23.3. The highest increase in Z(lr) scores was observed for 5p14.1-q12.1, where the maximum Z(lr) increased from 2.77 initially to 3.80 after fine mapping in the EA families.

Phase variable restriction-modification systems in Moraxella catarrhalis

A repetitive DNA motif was used as a marker to identify novel genes in the mucosal pathogen Moraxella catarrhalis. There is a high prevalence of such repetitive motifs in virulence genes that display phase variable expression. Two repeat containing loci were identified using a digoxigenin-labelled 5'-(CAAC)(6)-3' oligonucleotide probe. The repeats are located in the methylase components of two distinct type III restriction-modification (R-M) systems. We suggest that the phase variable nature of these R-M systems indicates that they have an important role in the biology of M. catarrhalis. (C) 2002 Published by Elsevier Science B.V. on behalf of the Federation of European Microbiological Societies.

Homologues of the maize rust resistance gene Rp1-D are genetically associated with a major rust resistance QTL in sorghum

As part of a comparative mapping study between sugarcane and sorghum, a sugarcane cDNA clone with homology to the maize Rp1-D rust resistance gene was mapped in sorghum. The cDNA probe hybridised to multiple loci, including one on sorghum linkage group (LG) E in a region where a major rust resistance QTL had been previously mapped. Partial sorghum Rp1-D homologues were isolated from genomic DNA of rust-resistant and -susceptible progeny selected from a sorghum mapping population. Sequencing of the Rp1-D homologues revealed five discrete sequence classes: three from resistant progeny and two from susceptible progeny. PCR primers specific to each sequence class were used to amplify products from the progeny and confirmed that the five sequence classes mapped to the same locus on LG E. Cluster analysis of these sorghum sequences and available sugarcane, maize and sorghum Rp1-D homologue sequences showed that the maize Rp1-D sequence and the partial sugarcane Rp1-D homologue were clustered with one of the sorghum resistant progeny sequence classes, while previously published sorghum Rp1-D homologue sequences clustered with the susceptible progeny sequence classes. Full-length sequence information was obtained for one member of a resistant progeny sequence class (Rp1-SO) and compared with the maize Rp1-D sequence and a previously identified sorghum Rp1 homologue (Rph1-2). There was considerable similarity between the two sorghum sequences and less similarity between the sorghum and maize sequences. These results suggest a conservation of function and gene sequence homology at the Rp1 loci of maize and sorghum and provide a basis for convenient PCR-based screening tools for putative rust resistance alleles in sorghum.