A strategy to fill gaps in soil survey over large spatial extents: an example from the Murray-Darling basin of Australia

We re-mapped the soils of the Murray-Darling Basin (MDB) in 1995-1998 with a minimum of new fieldwork, making the most out of existing data. We collated existing digital soil maps and used inductive spatial modelling to predict soil types from those maps combined with environmental predictor variables. Lithology, Landsat Multi Spectral Scanner (Landsat MSS), the 9-s digital elevation model (DEM) of Australia and derived terrain attributes, all gridded to 250-m pixels, were the predictor variables. Because the basin-wide datasets were very large data mining software was used for modelling. Rule induction by data mining was also used to define the spatial domain of extrapolation for the extension of soil-landscape models from existing soil maps. Procedures to estimate the uncertainty associated with the predictions and quality of information for the new soil-landforms map of the MDB are described. (C) 2002 Elsevier Science B.V. All rights reserved.

Impulses towards a multifunctional transition in rural Australia: Gaps in the research agenda

The direction, complexity and pace of rural change in affluent, western societies can be conceptualized as a multifunctional transition, in which a variable mix of consumption and protection values has emerged, contesting the former dominance of production values, and leading to greater complexity and heterogeneity in rural occupance at all scales. This transition is propelled by three dominant driving forces, namely: agricultural overcapacity; the emergence of market-driven amenity values; and growing societal awareness of sustainability and preservation issues. Australia's generous supply of land and sparse investment in agriculture has facilitated local transitions towards enhanced consumption and protection values, enabling a clearer delineation of emerging differentiated modes of rural occupance than in more contested locales. In Australia seven distinctive modes of occupance can be identified, according to the relative precedence given to production, consumption or protection values. These modes are described as: productivist agricultural; rural amenity; small farm (or pluriactive); peri-metropolitan; marginalized agricultural; conservation; and indigenous. Within these seven modes, alternative trajectories are identified, indicating variability in the intensity and type of resource use. Articulation of the transition concept may provide synergy between discrete discourses in rural research. (c) 2005 Elsevier Ltd. All rights reserved.

An exploratory study of gendered differences in young tourists perception of danger within London

This paper studies young tourists' perception of danger within the urban holiday environment of London, England. The study of perceived danger is important not only in its own right, but also because of the influence it may have on use of leisure spaces and times. This research assesses gender and group composition differences in perception of danger, addressing the relatively neglected issues of men's perception and the relationship between the genders. For the purpose of this paper 'danger' was assessed by studying how safe, relaxed, vulnerable, threatened, and at risk people felt while in London. The study found a number of similarities and differences between the men and women studied, in terms of how they perceived danger and their group composition during the day and nigh-time. These results indicate that gender may not be the only influence on perception and behaviour, and that men and women should not be regarded as-homogenous cohorts. (C) 2001 Elsevier Science Ltd. All rights reserved.

Closing the gap in curriculum development leadership

“Closing the gap in curriculum development leadership” is a Carrick-funded University of Queensland project which is designed to address two related gaps in current knowledge and in existing professional development programs for academic staff. The first gap is in our knowledge of curriculum and pedagogical issues as they arise in relation to multi-year sequences of study, such as majors in generalist degrees, or core programs in more structured degrees. While there is considerable knowledge of curriculum and pedagogy at the course or individual unit of study level (e.g. Philosophy I), there is very little properly conceptualised, empirically informed knowledge about student learning (and teaching) over, say, a three-year major sequence in a traditional Arts or Sciences subject. The Carrick-funded project aims to (begin to) fill this gap through bottom-up curriculum development projects across the range of UQ’s offerings. The second gap is in our professional development programs and, indeed, in our recognition and support for the people who are in charge of such multi-year sequences of study. The major convener or program coordinator is not as well supported, in Australian and overseas professional development programs, as the lecturer in charge of a single course (or unit of study). Nor is her work likely to be taken account of in workload calculations or for the purposes of promotion and career advancement more generally. The Carrick-funded project aims to fill this gap by developing, in consultation with crucial stakeholders, amendments to existing university policies and practices. The attached documents provide a useful introduction to the project. For more information, please contact Fred D’Agostino at f.dagostino@uq.edu.au.

Heterogeneity in inoculum potential and effectiveness of arbuscular mycorrhizal fungi

Arbuscular mycorrhizae are symbiotic associations among glomalean fungi and plant roots that often lead to enhanced water and nutrient uptake and plant growth. We describe experiments to test whether inoculum potential of arbuscular mycorrhizal (AM) fungal communities varies spatially within a broadleaf temperate forest, and also whether there is variability in the effectiveness of AM fungal communities in enhancing seedling growth. Inoculum potential of arbuscular mycorrhizal fungi in a temperate broad-leaved forest did not vary significantly among sites. Inoculum potential, measured as the extent to which the roots of red maple seedlings that had been germinated on sterile sand and then transplanted into the forest, were colonized by AM fungi, was similar in floodplain and higher elevation sites. It was as similar under ectomycorrhizal oaks as it was under red maples and other AM tree species. It was also similar among sites with deciduous understory shrubs with arbuscular mycorrhizae (spicebush, Lindera benzoin) and those with evergreen vegetation with ericoid mycorrhizae (mountain laurel, Kalmia latifolia). Where spicebush was the dominant understory shrub, inoculum potential was greater under gaps in the canopy than within the understory. Survivorship of transplanted red maple seedlings varied significantly over sites but was not strongly correlated with measures of inoculum potential. In a greenhouse growth experiment, arbuscular mycorrhizal fungal communities obtained from tree roots from the forest had different effects on plant growth. Seedlings inoculated with roots of red maple had twice the leaf area after 10 wk of growth compared to the AM community obtained from roots of southern red oaks. Thus, although there appears to be little heterogeneity in inoculum potential in the forest, there are differences in the effectiveness of different inocula. These effects have the potential to affect tree species diversity in forests by modifying patterns of seedling recruitment.

Feeding preference and deterrence in rabbitfish Siganus fuscescens for the cyanobacterium Lyngbya majuscula in Moreton Bay, south-east Queensland, Australia

Rabbitfish Siganus fuscescens preferences for Lyngbya majuscula collected from three bloom locations in Moreton Bay, Queensland, Australia, were tested along with a range of local plant species in the laboratory. Consumption of L. majuscula by fish did not differ between wild and captive-bred fish (P = 0.152) but did differ between bloom location (P = 0.039). No relationship was found between consumption rates and lyngbyatoxin-a concentration (r(2) = 0.035, P = 0.814). No correlation existed between C : N and proportion of food consumed when all food types were analysed statistically, whereas a clear correlation was observed when L. majuscula was removed from the calculations. In simulated bloom conditions, fish avoided ingestion of L. majuscula by feeding through gaps in the L. majuscula coverage. Both wild and captive-bred S. fuscescens showed a distinct feeding pattern in 10 day no-choice feeding assays, with less L. majuscula being consumed than the preferred red alga Acanthophora spicifera. Lyngbya majuscula however, was consumed in equal quantities to A. spicifera by wild S. fuscescens when lyngbyatoxin-a was not detectable. Wild fish probably do not preferentially feed on L. majuscula when secondary metabolites are present and are not severely impacted by large L. majuscula blooms in Moreton Bay. Furthermore, poor feeding performance in both captive-bred and wild S. fuscescens suggests that they would exert little pressure as a top-down control agent of toxic L. majuscula blooms within Moreton Bay. (c) 2006 The Fisheries Society of the British Isles.

Mental health literacy in rural Queensland: results of a community survey

Objectives: The aim of this study was to assess the awareness of, and attitudes to, mental health issues in rural dwelling Queensland residents. A secondary objective was to provide baseline data of mental health literacy prior to the implementation of Australian Integrated Mental Health Initiative - a health promotion strategy aimed at improving the health outcomes of people with chronic or recurring mental disorders. Method: In 2004 a random sample of 2% (2132) of the estimated adult population in each of eight towns in rural Queensland was sent a postal survey and invited to participate in the project. A series of questions were asked based on a vignette describing a person suffering major depression. In addition, questions assessed respondents' awareness and perceptions of community mental health agencies. Results: Approximately one-third (36%) of those surveyed completed and returned the questionnaire. While a higher proportion of respondents (81%) correctly identified and labelled the problem in the vignette as depression than previously reported in Australian community surveys, the majority of respondents (66%) underestimated the prevalence of mental health problems in the community. Furthermore, a substantial number of respondents (37%) were unaware of agencies in their community to assist people with mental health issues while a majority of respondents (57.6%) considered that the services offered by those agencies were poor. Conclusion: While mental health literacy in rural Queensland appears to be comparable to other Australian regions, several gaps in knowledge were identified. This is in spite of recent widespread coverage of depression in the media and thus, there is a continuing need for mental health education in rural Queensland.

Perceptions of mental health service delivery among staff and Indigenous consumers: it's still about communication

Objective: A needs analysis was undertaken to determine the quality and effectiveness of mental health services to Indigenous consumers within a health district of Southern Queensland. The study focussed on identifying gaps in the service provision for Indigenous consumers. Tools and methodologies were developed to achieve this. Method: Data were collected through the distribution of questionnaires to the target populations: district health service staff and Indigenous consumers. Questionnaires were developed through consultation with the community and the Steering Committee in order to achieve culturally appropriate wording. Of prime importance was the adaptation of questionnaire language so it would be fully understood by Indigenous consumers. Both questionnaires were designed to provide a balanced perspective of current mental health service needs for Indigenous people within the mental health service. Results: Results suggest that existing mental health services do not adequately meet the needs of Indigenous people. Conclusions: Recommendations arising from this study indicate a need for better communication and genuine partnerships between the mental health service and Indigenous people that reflect respect of cultural heritage and recognises the importance of including Indigenous people in the design and management of mental health services. Attention to the recommendations from this study will help ensure a culturally appropriate and effective mental health service for Indigenous consumers.

Population pharmacokinetics and pharmacodynamics: An underutilized resource

A meeting was convened in Canberra, Australia, at the request of the Australian Drug Evaluation Committee (ADEC), on December 3-4, 1997 to discuss the role of population pharmacokinetics and pharmacodynamics in drug evaluation and development. The ADEC was particularly concerned about registration of drugs in the pediatric age group. The population approach could be used more often than is currently the case in pharmacokinetic and pharmacodynamic studies to provide valuable information for the safe and effective use of drugs in neonates, infants, and children. The meeting ultimately broadened to include discussion about other subgroups. The main conclusions of the meeting were: 1. The population approach, pharmacokinetic and pharmacodynamic analysis, is a valuable tool both for drug registration purposes and for optimal dosing of drugs in specific groups of patients, 2. Population pharmacokinetic and pharmacodynamic studies are able to fill in the gaps' in registration of drugs, for example, to provide information on optimal pediatric dosing. Such studies provide a basis for enhancing product information to improve rational prescribing, 3. Expertise is required to perform the population studies and expertise, with a clinical perspective, is also required to evaluate such studies if they are to be submitted as part of a drug registration dossier Such expertise is available in the Australasian region and is increasing. Centers of excellence with the appropriate expertise to advise and assist should be encouraged to develop and grow in the region, 4. The use of the population approach by the pharmaceutical industry needs to be encouraged to provide valuable information not obtainable by other techniques. The acceptance of population pharmacokinetic and pharmacodynamic analyses by regulatory agencies also needs to be encouraged, and 5. Development of the population approach to pharmacokinetics and pharmacodynamics is needed from a public health perspective to ensure that all available information is collected and used to improve the way drugs are used. This important endeavor needs funding and support at the local and international levels.

The currency of case management: benefits and costs

Case management models evolved as the mental health care system shifted hospital to community settings. The research evidence underscores the efficacy of certain case management models under 'ideal' conditions; what is less clear, is how these models perform in day to day clinical practice. Moreover, the economic perspective adopted by most studies is relatively narrow thus limiting a proper understanding of the costs and benefits of such models. This paper reviews recent work in the field and highlights gaps in both method and application as a focus for future work. Curr Opin Psychiatry 12:195-199, (C) 1999 Lippincott Williams & Wilkins.

The N-15 natural abundance (delta N-15) of ecosystem samples reflects measures of water availability

We assembled a globally-derived data set for site-averaged foliar delta(15)N, the delta(15)N of whole surface mineral soil and corresponding site factors (mean annual rainfall and temperature, latitude, altitude and soil pH). The delta(15)N of whole soil was related to all of the site variables (including foliar delta(15)N) except altitude and, when regressed on latitude and rainfall, provided the best model of these data, accounting for 49% of the variation in whole soil delta(15)N. As single linear regressions, site-averaged foliar delta(15)N was more strongly related to rainfall than was whole soil delta(15)N. A smaller data set showed similar, negative correlations between whole soil delta(15)N, site-averaged foliar delta(15)N and soil moisture variations during a single growing season. The negative correlation between water availability (measured here by rainfall and temperature) and soil or plant delta(15)N fails at the landscape scale, where wet spots are delta(15)N-enriched relative to their drier surroundings. Here we present global and seasonal data, postulate a proximate mechanism for the overall relationship between water availability and ecosystem delta(15)N and, newly, a mechanism accounting for the highly delta(15)N-depleted values found in the foliage and soils of many wet/cold ecosystems. These hypotheses are complemented by documentation of the present gaps in knowledge, suggesting lines of research which will provide new insights into terrestrial N-cycling. Our conclusions are consistent with those of Austin and Vitousek (1998) that foliar (and soil) delta(15)N appear to be related to the residence time of whole ecosystem N.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Aboriginal and Torres Strait Islander health research and the conduct of longitudinal studies: issues for debate

The National Health and Medical Research Council, Research Agenda Working Group (RAWG), and the literature on Indigenous health have identified the need to fill gaps in descriptive data on Aboriginal and Torres Strait Islander health and noted both the lack of research with urban populations and the need for longitudinal studies. This paper presents some of the broad ethical and methodological challenges associated with longitudinal research in Indigenous health and focuses particularly on national studies and studies in urban areas. Our goal is to advance debate in the public health arena about the application of ethical guidelines and the conduct of longitudinal studies in Aboriginal and Torres Strait Islander communities. We encourage others to offer their experiences in this field.