The origin of a Robertsonian chromosomal translocation in house mice inferred from linked microsatellite markers

The Western European house mouse, Mus domesticus, includes many distinct Robertsonian (Rb) chromosomal races. Two competing hypotheses may explain the distribution of Rb translocations found in different populations: they may have arisen independently multiple times or they may have arisen once and been spread through long distance dispersal. We investigated the origin of the Rb 5.15 translocation using 6 microsatellite loci linked to the centromeres of chromosomes 5 and 15 in 84 individuals from 3 Rb populations and 4 neighboring standard-karyotype populations. Microsatellite variation on the 5.15 metacentric chromosomes was significantly reduced relative to the amount of variation found on acrocentric chromosomes 5 and 15, suggesting that linked microsatellite loci can track specific mutational events. Phylogenetic analyses resulted in trees which are consistent with multiple origins of the 5.15 metacentric found in the three Rb populations. These results suggest that cytologically indistinguishable mutations have arisen independently in natural populations of house mice.

FRA10B structure reveals common elements in repeat expansion and chromosomal fragile site genesis

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

Molecular cloning and chromosomal mapping of the human homologue of MYB binding protein (P160) 1A (MYBBP1A) to 17p13.3

We have previously isolated and characterized murine MYB binding protein (p160) 1a, a protein that specifically interacts with the leucine zipper motif within the negative regulatory domain of the c-Myb proto-oncoprotein, We now describe the molecular cloning of the human MYBBP1A cDNA and chromosomal localization to 17p13.3 by fluorescence in situ hybridization analysis, Given the likely presence of a tumor suppressor gene (or genes) within this region of chromosome 17, the position of MYBBP1A was further mapped by radiation hybrid analysis and was found to lie between markers D17S1828 and D17S938. A P1 artificial chromosome clone containing the 5' region of MYBBP1A was isolated and indicates a physical linkage between MYBBP1A and the 15-lipoxygenase gene (ALOX15), A novel, polymorphic (CA)(25) dinucleotide repeat was also isolated from this PAC and may serve as a useful marker for MYBBP1A and this region of chromosome 17. (C) 1999 Academic Press.

Chromosomal fragile site FRA16D and DNA instability in cancer

It has been proposed that common aphidicolin-inducible fragile sites, in general, predispose to specific chromosomal breakage associated with deletion, amplification, and/or translocation in certain forms of cancer. Although this appears to be the case for the fragile site FRA3B and may be the case for FRA7G, it is not Set clear whether this association is a general property of this class of fragile site. The major aim of the present study was to determine whether the FRA16D chromosomal fragile site locus has a role to play in predisposing DNA sequences within and adjacent to the fragile site to DNA instability (such as deletion or translocation), which could lead to or be associated with neoplasia. We report the localization of FRA16D within a contig of cloned DNA and demonstrate that this fragile site coincides with a region of homozygous deletion in a gastric adenocarcinoma cell line and is bracketed by translocation breakpoints in multiple myeloma, as reported previously (Chesi, M., et al., Blood, 91: 4457-4463, 1998), Therefore, given similar findings at the FRA3B and FRA7G fragile sites, it is likely that common aphidicolin-inducible fragile sites exhibit the general property of localized DNA instability in cancer cells.

Common chromosomal fragile site FRA16D sequence: identification of the FOR gene spanning FRA16D and homozygous deletions and translocation breakpoints in cancer cells

Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cytogenetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.

Extensive chromosomal variation associated with taxon divergence and host specificity in the gall-inducing scale insect Apiomorpha munita (Schrader) (Hemiptera : Sternorrhyncha : Coccoidea : Eriococcidae)

Apiomorpha Rubsaamen (Hemiptera: Coccoidea: Eriococcidae) is one of the most chromosomally diverse of all animal genera. There is extensive karyotypic variation within many of the morphologically defined species, including A. munita (Schrader) which is here reported to have diploid chromosome counts ranging from 6 to more than 100. Each of the three morphologically defined subspecies of A. munita also displays considerable chromosomal variation: A. m. tereticornuta Gullan (2n =6, 8, 20, 22 or 24), A. m. malleensis Gullan (2n =6, 20, 22, 24 or 26), and A. m. munita (Schrader) (2n=54 or >100). Apiomorpha munita appears to occur only on eucalypts of the informal subgenus Symphyomyrtus, with each of the subspecies of A. munita restricted to discrete symphyomyrt sections. Several different karyotypic forms within each subspecies of A. munita appear to be restricted to only one or a few eucalypt species or series. The association between apparent host specificity and chromosomal rearrangements in A. munita suggests that both may be playing an active role in taxon divergence in Apiomorpha. (C) 2001 The Linnean Society of London.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Chromosomal gains and losses in ocular melanoma detected by comparative genomic hybridization in an Australian population-based study

To define the location of potential oncogenes and tumor suppressor genes in ocular melanoma we carried out comparative genomic hybridization (CGH) analysis on a population-based series of 25 formalin-fixed, paraffin-embedded primary tumors comprising 17 choroidal, 2 ciliary body, 4 iris, and 2 conjunctival melanomas. Twelve (48%) of the 25 melanomas showed no chromosomal changes and 13 (52%) had at least one chromosomal gain or loss. The mean number of CGH changes in all tumors was 3.3, with similar mean numbers of chromosomal gains (1.5) and losses (1.8). The highest number of chromosomal changes (i.e., nine) occurred in a conjunctival melanoma and included four changes not observed in tumors at any other ocular site (gains in 22q and 11p and losses in 6p and 17p). The most frequent gains in all primary ocular melanomas were on chromosome arm 8q (69%), 6p (31%) and 8p (23%) and the most frequent losses were on 6q (38%), 10q (23%), and 16q (23%). The most common pairing was gain in 8p and gain in 8q, implying a whole chromosome copy number increase; gains in 8p occurred only in conjunction with gains in 8q. The smallest regions of copy number alteration were mapped to gain of 8q21 and loss of 6q21, 10q21, and 16q22. Sublocalization of these chromosomal changes to single-band resolution should accelerate the identification of genes involved in the genesis of ocular melanoma.

Chromosomal genotoxicity of nitrobenzene and benzonitrile

In order to investigate the chromosomal genotoxicity of nitrobenzene and benzonitrile, we studied the induction of micronuclei (MN) by these test compounds in V79 cells, as well as effects on the formation and stability of microtubules and on motor protein functions. No cytotoxicity was seen in V79 cell cultures in terms of Neutral red uptake after 18 h treatment with up to 1 mM nitrobenzene or 1 mM benzonitrile. Subsequently, a concentration range up to 100 muM was used in the experiments on induction of MN. Both test compounds exhibit a weak, but definitely positive test result compared to the solvent (DMSO) control. Minimal effect concentrations of nitrobenzene and benzonitrile appeared as low as 0.01 muM, and no-effect-concentrations were between 0.001 and 0.005 muM. Clearly enhanced MN rates were found at 0.1 muM and higher. Both, nitrobenzene and benzonitrile, induced mostly kinetochor (CREST)-positive micronuclei, thus characterising the chromosomal effects as aneugenic. In cell-free assays, a slight effect on tubulin assembly was observed at 1 mM nitrobenzene without addition of DMSO. Higher concentrations (5 mM) led to secondary effects. In presence of 1% DMSO, nitrobenzene exerted no detectable effect on tubulin assembly up to the solubility limit in water of about 15 mM. For benzonitrile in presence of DMSO, a clear dose-response of inhibition of tubulin assembly at 37degreesC was seen above the no-effect-concentration of 2 mM, with an IC50 of 13 mM and protein denaturation starting above a level of about 20 mM. The nature of the effects of nitrobenzene and benzonitrile on the association of tubulin to form microtubules was confirmed by electron microscopy. Treatment by either 5 mM nitrobenzene or 13 mM benzonitrile plus 1% DMSO left the microtubular structure intact whereas 5 mM nitrobenzene, in absence of DMSO, led to irregular cluster formations. The experiments demonstrate that both nitrobenzene and benzonitrile, in millimolar concentration ranges, may lead to interference with tubulin assembly in a cell-free system. The functionality of the tubulin-kinesin motor protein system was assessed using the microtubule gliding assay. Nitrobenzene affected the gliding velocity in a concentration-dependent manner, starting at about 7.5 muM and reaching complete inhibition of motility at 30 muM, whereas benzonitrile up to 200 muM did not affect the kinesin-driven gliding velocity. The micronucleus assay data demonstrate a chromosomal endpoint of genotoxicity of nitrobenzene and benzonitrile. Aneugenic effects of both compounds occur at remarkably low concentrations, with lowest-effect-concentrations being 0.1 muM. This points to the relevance of interactions with the cellular spindle apparatus.

A rapid single-step multiplex method for discriminating between Trichogramma (Hymenoptera: Trichogrammatidae) species in Australia

Inaccurate species identification confounds insect ecological studies. Examining aspects of Trichogramma ecology pertinent to the novel insect resistance management strategy for future transgenic cotton, Gossypium hirsutum L., production in the Ord River Irrigation Area (ORIA) of Western Australia required accurate differentiation between morphologically similar Trichogramma species. Established molecular diagnostic methods for Trichogramma identification use species-specific sequence difference in the internal transcribed spacer (ITS)-2 chromosomal region; yet, difficulties arise discerning polymerase chain reaction (PCR) fragments of similar base pair length by gel electrophoresis. This necessitates the restriction enzyme digestion of PCR-amplified ITS-2 fragments to readily differentiate Trichogramma australicum Girault and Trichogramma pretiosum Riley. To overcome the time and expense associated with a two-step diagnostic procedure, we developed a “one-step” multiplex PCR technique using species-specific primers designed to the ITS-2 region. This approach allowed for a high-throughput analysis of samples as part of ongoing ecological studies examining Trichogramma biological control potential in the ORIA where these two species occur in sympatry.

Hepatocellular carcinoma

Detailed analyses of chromosomal damage in hepatocellular carcinoma have confirmed the results of previous studies that identified regions of significant loss. In addition, these studies examined the clinicopathological correlates of this damage, identified new sites for future investigation, and provided evidence of interactions between genes, The insulin-like growth factor II receptor gene is a target for inactivation through chromosomal loss and mutation, with loss also occurring in the cirrhotic liver. The insulin-like growth factor II receptor gene plays a central role in coordinating the competing actions of insulin-like growth factor and transforming growth factor-beta on cell proliferation. Our understanding of the changes in these growth factor pathways helps explain the apparent increase in risk of hepatocellular carcinoma in diabetic patients and the potential use of urinary transforming growth factor-beta in screening tests. Vaccination for hepatitis B in Taiwan has had a significant effect on the incidence of childhood hepatocellular carcinoma. Universal vaccination should result in a major reduction in the incidence of hepatocellular carcinoma worldwide.

A sponge/dinoflagellate association in the haplosclerid sponge Haliclona sp.: cellular origin of cytotoxic alkaloids by Percoll density gradient fractionation

Light-microscopic and electron-microscopic studies of the tropical marine sponge Haliclona sp. (Or der: Haplosclerida Family: Haliclonidae) from Heron Island, Great Barrier Reef, have revealed that this sponge is characterized by the presence of dinoflagellates and by nematocysts. The dinoflagellates are 7-10 mu m in size, intracellular, and contain a pyrenoid with a single stalk, whereas the single chloroplast is branched, curved, and lacks grana. Mitochondria are present, and the nucleus is oval and has distinct chromosomal structure. The dinoflagellates are morphologically similar to Symbiodinium microadriaticum, the common intracellular symbiont of corals, although more detailed biochemical and molecular studies are required to provide a precise taxonomic assignment. The major sponge cell types found in Haliclona sp, are spongocytes, choanocytes, and archaeocytes; groups of dinoflagellates are enclosed within large vacuoles in the archaeocytes. The occurrence of dinoflagellates in marine sponges has previously been thought to be restricted to a small group of sponges including the excavating hadromerid sponges; the dinoflagellates in these sponges are usually referred to as symbionts. The role of the dinoflagellates present in Haliclona sp. as a genuine symbiotic partner requires experimental investigation. The sponge grows on coral substrates, from which it may acquire the nematocysts, and shows features, such as mucus production, which are typical of some excavating sponges. The cytotoxic alkaloids, haliclonacyclamines A and B, associated with Haliclona sp. are shown by Percoll density gradient fractionation to be localized within the sponge cells rather than the dinoflagellates. The ability to synthesize bioactive compounds such as the haliclonacyclamines may help Haliclona sp. to preserve its remarkable ecological niche.

What the evolution of the amyloid protein precursor supergene family tells us about its function

The Alzheimer's disease amyloid protein precursor (APP) gene is part of a multi-gene super-family from which sixteen homologous amyloid precursor-like proteins (APLP) and APP species homologues have been isolated and characterised. Comparison of exon structure (including the uncharacterised APL-1 gene), construction of phylogenetic trees, and analysis of the protein sequence alignment of known homologues of the APP super-family were performed to reconstruct the evolution of the family and to assess the functional significance of conserved protein sequences between homologues. This analysis supports an adhesion function for all members of the APP super family, with specificity determined by those sequences which are not conserved between APLP lineages, and provides evidence for an increasingly complex APP superfamily during evolution. The analysis also suggests that Drosophila APPL and Caenorhabdotids elegans APL-1 may be a fourth APLP lineage indicating that these proteins, while not functional homologues of human APP, are similarly likely to regulate cell adhesion. Furthermore, the beta A4 sequence is highly conserved only in APP orthologues, strongly suggesting this sequence is of significant functional importance in this lineage. (C) 2000 Elsevier Science Ltd. All rights reserved.