Lingual kinematic strategies used to increase speech rate: Comparisons between younger and older adults

The primary objective of this study was to assess the lingual kinematic strategies used by younger and older adults to increase rate of speech. It was hypothesised that the strategies used by the older adults would differ from the young adults either as a direct result of, or in response to a need to compensate for, age-related changes in the tongue. Electromagnetic articulography was used to examine the tongue movements of eight young (M526.7 years) and eight older (M567.1 years) females during repetitions of /ta/ and /ka/ at a controlled moderate rate and then as fast as possible. The younger and older adults were found to significantly reduce consonant durations and increase syllable repetition rate by similar proportions. To achieve these reduced durations both groups appeared to use the same strategy, that of reducing the distances travelled by the tongue. Further comparisons at each rate, however, suggested a speed-accuracy trade-off and increased speech monitoring in the older adults. The results may assist in differentiating articulatory changes associated with normal aging from pathological changes found in disorders that affect the older population.

Distribution of major, minor, and trace metals in lake environments of Antarctica

The concentrations of major, minor and trace metals were measured in water samples collected from five shallow Antarctic lakes (Carezza, Edmonson Point (No 14 and 15a), Inexpressible Island and Tarn Flat) found in Terra Nova Bay (northern Victoria Land, Antarctica) during the Italian Expeditions of 1993-2001. The total concentrations of a large suite of elements (Al, As, Ba, Ca, Cd, Ce, Co, Cr, Cs, Cu, Fe, Ga, Gd, K, La, Li, Mg, Mn, Mo, Na, Nd, Ni, Pb, Pr, Rb, Sc, Si, Sr, Ta, Ti, U, V, Y, W, Zn and Zr) were determined using spectroscopic techniques (ICP-AES, GF-AAS and ICP-MS). The results are similar to those obtained for the freshwater lakes of the Larsemann Hills, East Antarctica, and for the McMurdo Dry Valleys. Principal Component Analysis (PCA) and Cluster Analysis (CA) were performed to identify groups of samples with similar characteristics and to find correlations between the variables. The variability observed within the water samples is closely connected to the sea spray input; hence, it is primarily a consequence of geographical and meteorological factors, such as distance from the ocean and time of year. The trace element levels, in particular those of heavy metals, are very low, suggesting an origin from natural sources rather than from anthropogenic contamination.

Medication prescribing and administration in nursing homes

Objective: to examine the key determinants of pharmaco-epidemiology in Australian nursing homes. Design: a cross-sectional survey of medication use in 998 residents in 15 nursing homes in Southern Queensland and Northern New South Wales, Results: the total, laxative, digoxin/diuretic, benzodiazepine and psycholeptic medication prescribed and administered to residents of nursing homes was affected to differing extents by age and gender, the nursing home, resident functional disability and medical practitioner. Resident Classification Instrument (RCI) category and nursing home were the dominant determinants for prescribing and administration of the total drugs, laxative, benzodiazepine and psycholeptic medications. In contrast, the resident use of digoxin and/or diuretics was dependent on the resident age and on the functional disability (RCI category) of the resident but not medical practitioner or nursing home. Approximately 30% of medications were prescribed on a pro re nata (p.r.n.) basis and administered at the discretion of registered nurses. Conclusion: nursing home culture is a major determinant of the variability in medication use between residents, particularly for those medications often prescribed for p.r.n. use. The nursing home does not account for variation in the use of digoxin and/or diuretics which are prescribed on a non-discretionary basis.

Tension regulation during lengthening and shortening actions of the human soleus muscle

In the present study we investigated tension regulation in the human soleus (SOL) muscle during controlled lengthening and shortening actions. Eleven subjects performed plantar flexor efforts on an ankle torque motor through 30 degrees of ankle displacement (75 degrees-105 degrees internal ankle angle) at lengthening and shortening velocities of 5, 15 and 30 degrees s(-1). To isolate the SOL from the remainder of the triceps surae, the subject's knee was flexed to 60 degrees during all trials. Voluntary plantar flexor efforts were performed under two test conditions: (1) maximal voluntary activation (MVA) of the SOL, and (2) constant submaximal voluntary activation (SVA) of the SOL. SVA trials were performed with direct visual feedback of the SOL electromyogram (EMG) at a level resulting in a torque output of 30% of isometric maximum. Angle-specific (90 degrees ankle angle) torque and EMG of the SOL, medial gastrocnemius (MG) and tibialis anterior (TA) were recorded. In seven subjects from the initial group, the test protocol was repeated under submaximal percutaneous electrical activation (SEA) of SOL (to 30% isometric maximal effort). Lengthening torques were significantly greater than shortening torques in all test conditions. Lengthening torques in MVA and SVA were independent of velocity and remained at the isometric level, whereas SEA torques were greater than isometric torques and increased at higher lengthening velocities. Shortening torques were lower than the isometric level for all conditions. However, whereas SVA and SEA torques decreased at higher velocities of shortening, MVA torques were independent of velocity. These results indicate velocity- and activation-type-specific tension regulation in the human SOL muscle.

Identification of novel non-autonomous CemaT transposable elements and evidence of their mobility within the C. elegans genome

We describe here two new transposable elements, CemaT4 and CemaT5, that were identified within the sequenced genome of Caenorhabditis elegans using homology based searches. Five variants of CemaT4 were found, all non-autonomous and sharing 26 bp inverted terminal repeats (ITRs) and segments (152-367 bp) of sequence with similarity to the CemaT1 transposon of C. elegans. Sixteen copies of a short, 30 bp repetitive sequence, comprised entirely of an inverted repeat of the first 15 bp of CemaT4's ITR, were also found, each flanked by TA dinucleotide duplications, which are hallmarks of target site duplications of mariner-Tc transposon transpositions. The CemaT5 transposable element had no similarity to maT elements, except for sharing identical ITR sequences with CemaT3. We provide evidence that CemaT5 and CemaT3 are capable of excising from the C. elegans genome, despite neither transposon being capable of encoding a functional transposase enzyme. Presumably, these two transposons are cross-mobilised by an autonomous transposon that recognises their shared ITRs. The excisions of these and other non-autonomous elements may provide opportunities for abortive gap repair to create internal deletions and/or insert novel sequence within these transposons. The influence of non-autonomous element mobility and structural diversity on genome variation is discussed.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

A family of cytokine-inducible inhibitors of signalling

Cytokines are secreted proteins that regulate important cellular responses such as proliferation and differentiation(1). Key events in cytokine signal transduction are well defined: cytokines induce receptor aggregation, leading to activation of members of the JAK family of cytoplasmic tyrosine kinases. In turn, members af the STAT family of transcription factors are phosphorylated, dimerize and increase the transcription of genes with STAT recognition sites in their promoters(1-4). Less is known of how cytokine signal transduction is switched off. We have cloned a complementary DNA encoding a protein SOCS-1, containing an SH2-domain, by its ability to inhibit the macrophage differentiation of M1 cells in response to interleukin-6. Expression of SOCS-1 inhibited both interleukin-6-induced receptor phosphorylation and STAT activation. We have also cloned two-relatives of SOCS-1, named SOCS-2 and SOCS-3, which together with the previously described CIS (ref. 5) form a new family of proteins. Transcription of all four SOCS genes is increased rapidly in response to interleukin-6, in vitro and in vivo, suggesting they may act in a classic negative feedback loop to regulate cytokine signal transduction.

Sintering kinetics of Mo-free cermets

Titanium carbonitride-based cermets are important materials for contemporary cutting tools. Ceramic powders of Ti(CN), TaC, WC were mixed, compacted and heat-treated at high temperatures to form (Ti, W, Ta)(C, N) solid solution, which was then ball-milled to fine powders before being mixed with metallic binder and compacted. Liquid-phase sintering of the samples was carried out in a nitrogen atmosphere at different sintering temperatures and holding times. The microhardness and porosity of the sintered cermets were studied. It is demonstrated that the microhardness increases with sintering temperature, but at the same time, the porosity level also goes up with temperature and time. At the beginning of sintering (zero holding time), the majority of the pores are small (0.1 similar to 1 mu m); during sintering, the larger ports grow at the expense of smaller pores and the resulting pores are all concentrated in the 10 similar to 100 mu m range. The number of larger pores increases with temperature and prolonged holding time, which results in deteriorated properties. (C) 1997 Elsevier Science S.A.

A sensitive vorticity gauge using rotated porphyroblasts, and its application to rocks adjacent to the Alpine Fault, New Zealand

Variable aspect ratio porphyroblasts deformed in non-coaxial flow. and internally containing rotated relicts of an external foliation, can be used to characterise plane strain flow regimes. The distribution obtained by plotting the orientation of the long axis of such grains, classified by aspect ratio, against the orientation of the internal foliation is potentially a sensitive gauge of both the bulk shear strain (as previously suggested) and kinematic vorticity number. We illustrate the method using rotated biotite porphyroblasts in the Alpine Schist: a sequence of mid-crustal rocks that have been ramped to the surface along the Alpine Fault. a major transpressional plate boundary. Results indicate that, at distances greater than or equal to similar to1 km from the fault, the rocks have undergone a combination of irrotational fattening and dextral-oblique, normal-sense shear, with a bulk shear strain of similar to0.6 and kinematic vorticity number of similar to0.2. The vorticity analysis is compatible with estimates of strongly oblate bulk strain of similar to 75% maximum shortening. Dextral-reverse transpressional flow characterises higher strain S-tectonite mylonite within similar to1 km of the Alpine Fault. These relationships provide insight into the kinematics of flow and distribution of strain in the hangingwall of the Alpine Fault and place constraints on numerical mechanical models for the exhumation of these mid-crustal rocks. (C) 2001 Elsevier Science Ltd. All rights reserved.

Medullary neurones regulate hypothalamic corticotropin-releasing factor cell responses to an emotional stressor

Hypothalamic-pituitary-adrenal axis activation is a hallmark of the stress response. In the case of physical stressors, there is considerable evidence that medullary catecholamine neurones are critical to the activation of the paraventricular nucleus corticotropin-releasing factor cells that constitute the apex of the hypothalamic-pituitary-adrenal axis. In contrast, it has been thought that hypothalamic-pituitary-adrenal axis responses to emotional stressors do not involve brainstem neurones. To investigate this issue we have mapped patterns of restraint-induced neuronal c fos expression in intact animals and in animals prepared with either paraventricular nucleus-directed injections of a retrograde tracer, lesions of paraventricular nucleus catecholamine terminals, or lesions of the medulla corresponding to the A1 or A2 noradrenergic cell groups. Restraint-induced patterns of neuronal activation within the medulla of intact animals were very similar to those previously reported in response to physical stressors, including the fact that most stressor-responsive, paraventricular nucleus-projecting cells were certainly catecholaminergic and probably noradrenergic. Despite this, the destruction of paraventricular nucleus catecholamine terminals with 6-hydroxydopamine did not alter corticotropin-releasing factor cell responses to restraint. However, animals with ibotenic acid lesions encompassing either the A1 or A2 noradrenergic cell groups displayed significantly suppressed corticotropin-releasing factor cell responses to restraint. Notably, these medullary lesions also suppressed neuronal responses in the medial amygdala, an area that is now considered critical to hypothalamic-pituitary-adrenal axis responses to emotional stressors and that is also known to display a significant increase in noradrenaline turnover during restraint. We conclude that medullary neurones influence corticotropin-releasing factor cell responses to emotional stressors via a multisynaptic pathway that may involve a noradrenergic input to the medial amygdala. These results overturn the idea that hypothalamic-pituitary-adrenal axis response to emotional stressors can occur independently of the brainstem. (C) 2001 IBRO. Published by Elsevier Science Ltd. All rights reserved.

Stressor categorization: acute physical and psychological stressors elicit distinctive recruitment patterns in the amygdala and in medullary noradrenergic cell groups

It has been hypothesized that the brain categorizes stressors and utilizes neural response pathways that vary in accordance with the assigned category. If this is true, stressors should elicit patterns of neuronal activation within the brain that are category-specific. Data from previous Immediate-early gene expression mapping studies have hinted that this is the case, but interstudy differences in methodology render conclusions tenuous. In the present study, immunolabelling for the expression of c-fos was used as a marker of neuronal activity elicited in the rat brain by haemorrhage, immune challenge, noise, restraint and forced swim. All stressors elicited c-fos expression in 25-30% of hypothalamic paraventricular nucleus corticotrophin-releasing-factor cells, suggesting that these stimuli were of comparable strength, at least with regard to their ability to activate the hypothalamic-pituitary-ad renal axis. In the amygdala, haemorrhage and immune challenge both elicited c-fos expression in a large number of neurons in the central nucleus of the amygdala, whereas noise, restraint and forced swim primarily elicited recruitment of cells within the medial nucleus of the amygdala. In the medulla, all stressors recruited similar numbers of noradrenergic (A1 and A2) and adrenergic (C1 and C2) cells. However, haemorrhage and immune challenge elicited c-fos expression In subpopulations of A1 and A2 noradrenergic cells that were significantly more rostral than those recruited by noise, restraint or forced swim. The present data support the suggestion that the brain recognizes at least two major categories of stressor, which we have referred to as 'physical' and 'psychological'. Moreover, the present data suggest that the neural activation footprint that is left in the brain by stressors can be used to determine the category to which they have been assigned by the brain.

Using a cartographic modeling language to manipulate spectral satellite imagery

Land related information about the Earth's surface is commonIJ found in two forms: (1) map infornlation and (2) satellite image da ta. Satellite imagery provides a good visual picture of what is on the ground but complex image processing is required to interpret features in an image scene. Increasingly, methods are being sought to integrate the knowledge embodied in mop information into the interpretation task, or, alternatively, to bypass interpretation and perform biophysical modeling directly on derived data sources. A cartographic modeling language, as a generic map analysis package, is suggested as a means to integrate geographical knowledge and imagery in a process-oriented view of the Earth. Specialized cartographic models may be developed by users, which incorporate mapping information in performing land classification. In addition, a cartographic modeling language may be enhanced with operators suited to processing remotely sensed imagery. We demonstrate the usefulness of a cartographic modeling language for pre-processing satellite imagery, and define two nerv cartographic operators that evaluate image neighborhoods as post-processing operations to interpret thematic map values. The language and operators are demonstrated with an example image classification task.

Human GC-AG alternative intron isoforms with weak donor sites show enhanced consensus at acceptor exon positions

It has been previously observed that the intrinsically weak variant GC donor sites, in order to be recognized by the U2-type spliceosome, possess strong consensus sequences maximized for base pair formation with U1 and U5/U6 snRNAs. However, variability in signal strength is a fundamental mechanism for splice site selection in alternative splicing. Here we report human alternative GC-AG introns (for the first time from any species), and show that while constitutive GC-AG introns do possess strong signals at their donor sites, a large subset of alternative GC-AG introns possess weak consensus sequences at their donor sites. Surprisingly, this subset of alternative isoforms shows strong consensus at acceptor exon positions 1 and 2. The improved consensus at the acceptor exon can facilitate a strong interaction with U5 snRNA, which tethers the two exons for ligation during the second step of splicing. Further, these isoforms nearly always possess alternative acceptor sites and always possess alternative acceptor sites and exhibit particularly weak polypyrimidine tracts characteristic of AG-dependent introns. The acceptor exon nucleotides are part of the consensus required for the U2AF(35)-mediated recognition of AG in such introns. Such improved consensus at acceptor exons is not found in either normal or alternative GT-AG introns having weak donor sites or weak polypyrimidine,tracts. The changes probably reflect mechanisms that allow GC-AG alternative intron isoforms to cope with two conflicting requirements, namely an apparent need for differential splice strength to direct the choice of alternative sites and a need for improved donor signals to compensate for the central mismatch base pair (C-A) in the RNA duplex of U1 snRNA and the pre-mRNA. The other important findings include (i) one in every twenty alternative introns is a GC-AG intron, and (ii) three of every five observed GC-AG introns are alternative isoforms.