26 resultados para RI geográfica
em University of Queensland eSpace - Australia
Resumo:
A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.
Resumo:
The tropical marine sponge Dysidea herbacea (Keller) contains the filamentous unicellular cyanobacterium Oscillatoria spongeliae (Schulze) Hauck as an endosymbiont, plus numerous bacteria, both intracellular and extracellular. Archaeocytes and choanocytes are the major sponge cell types present. Density gradient centrifugation of glutaraldehyde-fixed cells with Percoll as the support medium has been used to separate the cyanobacterial symbiont from the sponge cells on the basis of their differing densities. The protocol also has the advantage of separating broken from intact cells of O. spongeliae. The lighter cell preparations contain archaeocytes and choanocytes together with damaged cyanobacterial cells, whereas heavier cell preparations contain intact cyanobacterial cells, with less than 1% contamination by sponge cells. Gas chromatography/mass spectrometry analysis has revealed that the terpene spirodysin is concentrated in preparations containing archaeocytes and choanocytes, whereas nuclear magnetic resonance analysis of the symbiont cell preparations has shown that they usually contain the chlorinated diketopiperazines, dihydrodysamide C and didechlorodihydrodysamide C, which are the characteristic metabolites of the sponge/symbiont association. However, one symbiont preparation, partitioned by a second Percoll gradient, has been found to be devoid of chlorinated diketopiperazines. The capability to synthesize secondary metabolites may depend on the physiological state of the symbiont; alternatively, there may be two closely related cyanobacterial strains within the sponge tissue.
Resumo:
Light-microscopic and electron-microscopic studies of the tropical marine sponge Haliclona sp. (Or der: Haplosclerida Family: Haliclonidae) from Heron Island, Great Barrier Reef, have revealed that this sponge is characterized by the presence of dinoflagellates and by nematocysts. The dinoflagellates are 7-10 mu m in size, intracellular, and contain a pyrenoid with a single stalk, whereas the single chloroplast is branched, curved, and lacks grana. Mitochondria are present, and the nucleus is oval and has distinct chromosomal structure. The dinoflagellates are morphologically similar to Symbiodinium microadriaticum, the common intracellular symbiont of corals, although more detailed biochemical and molecular studies are required to provide a precise taxonomic assignment. The major sponge cell types found in Haliclona sp, are spongocytes, choanocytes, and archaeocytes; groups of dinoflagellates are enclosed within large vacuoles in the archaeocytes. The occurrence of dinoflagellates in marine sponges has previously been thought to be restricted to a small group of sponges including the excavating hadromerid sponges; the dinoflagellates in these sponges are usually referred to as symbionts. The role of the dinoflagellates present in Haliclona sp. as a genuine symbiotic partner requires experimental investigation. The sponge grows on coral substrates, from which it may acquire the nematocysts, and shows features, such as mucus production, which are typical of some excavating sponges. The cytotoxic alkaloids, haliclonacyclamines A and B, associated with Haliclona sp. are shown by Percoll density gradient fractionation to be localized within the sponge cells rather than the dinoflagellates. The ability to synthesize bioactive compounds such as the haliclonacyclamines may help Haliclona sp. to preserve its remarkable ecological niche.
Resumo:
In thin sections of resin-embedded samples of glutaraldehyde- and osmium tetroxide-fixed tissue from five genera of marine sponges, Stromatospongia, Astrosclera, Jaspis, Pseudoceratina and Axinyssa, cells of a bacteria-like symbiont microorganism which exhibit a membrane-bounded nuclear region encompassing the fibrillar nucleoid have been observed within the sponge mesohyl. The nuclear region in these cells is bounded by a single bilayer membrane, so that the cell cytoplasm is divided into two distinct regions. The cell wall consists of subunits analogous to those in walls of some Archaea. Cells of the sponge symbionts observed here are similar to those of the archaeal sponge symbiont Cenarchaeum symbiosum. (C) 1998 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved.
Resumo:
We report the detection of living colonies of nano-organisms (nanobes) on Triassic and Jurassic sandstones and other substrates. Nanobes have cellular structures that are strikingly similar in morphology to Actinomycetes and fungi (spores, filaments, and fruiting bodies) with the exception that they are up to 10 times smaller in diameter (20 nm to 1.0 mu m). Nanobes are noncrystalline structures that are composed of C, O, and N. Ultra thin sections of nanobes show the existence of an outer layer or membrane that may represent a cell wall. This outer layer surrounds an electron dense region interpreted to be the cytoplasm and a less electron dense central region that may represent a nuclear area. Nanobes show a positive reaction to three DNA stains, [4',6-diamidino-2 phenylindole (DAPI), Acridine Orange, and Feulgen], which strongly suggests that nanobes contain DNA. Nanobes are communicable and grow in aerobic conditions at atmospheric pressure and ambient temperatures. While morphologically distinct, nanobes are in the same size range as the controversial fossil nannobacteria described by others in various rock types and in the Martian meteorite ALH84001.
Resumo:
Monocrotaline is a pyrrolizidine alkaloid known to cause toxicity in humans and animals. Its mechanism of biological action is still unclear although DNA crosslinking has been suggested to a play a role in its activity. In this study we found that an active metabolite of monocrotaline, dehydromonocrotaline (DHM), alkylates guanines at the N7 position of DNA with a preference for 5'-GG and 5'-GA sequences; In addition, it generates piperidine- and heat-resistant multiple DNA crosslinks, as confirmed by electrophoresis and electron microscopy. On the basis of these findings, we propose that DHM undergoes rapid polymerization to a structure which is able to crosslink several fragments of DNA.
Resumo:
Tissue susceptibility and resistance to infection with the yeast Candida albicans is genetically regulated. Analysis of the strain distribution pattern of the C. albicans resistance gene (Carg1) and additional gene and DNA segment markers in the AKXL recombinant inbred (RI) set showed that 13/15 RI strains were concordant for Carg1, Tcra and Rib1. Therefore, Carg1 is probably located within a 17 cM segment of chromosome 14, within approximately 4 cM of the other two genes. (C) 1998 Academic Press.
Resumo:
Past studies have shown that apoptosis mediated by TNF-related apoptosis-inducing ligand (TRAIL) is regulated by the expression of two death receptors [TRAIL receptor 1 (TRAIL-RI) and TRAIL-R2] and two decoy receptors (TRAIL-R3 and TRAIL-R4) that inhibit apoptosis, In previous studies, me have shown that TRAIL but not other members of the tumor necrosis factor family induce apoptosis in approximately two-thirds of melanoma cell lines. Here, we examined whether the expression of TRAIL-R at the mRNA and protein level in a panel of 28 melanoma cell lines and melanocytes correlated with their sensitivity to TRAIL-induced apoptosis, We report that at least three factors appear to underlie the variability in TRAIL-induced apoptosis. (a) Pour of nine cell lines that were insensitive to TRAIL-induced apoptosis failed to express death receptors, and in two instances, lines were devoid of all TRAIL-Rs. Southern analysis suggested this was due to loss of the genes for the death receptors, (b) Despite the presence of mRNA for the TRAIL-R, some of the lines failed to express TRAIL-R protein on their surface. This was evident for TRAIL-RI and more so for the TRAIL decoy receptors TRAIL-R3 and -R4, Studies on permeabilized cells revealed that the receptors were located within the cytoplasm and redistribution from the cytoplasm may represent a posttranslational control mechanism. (c) Surface expression of TRAIL-RI and -R2 (but not TRAIL-R3 and -R4) showed an overall correlation with TRAIL-induced apoptosis. However, certain melanoma cell lines and clones were relatively resistant to TRAIL-induced apoptosis despite the absence of decoy receptors and moderate levels of TRAIL-RI and -R2 expression. This may indicate the presence of inhibitors within the cells, but resistance to apoptosis could not be correlated with expression of the caspase inhibitor FLICE-inhibitory protein. mRNA for another TRAIL receptor, osteoprotegerin, was expressed in 22 of the melanoma lines but not on melanocytes. Its role in induction of apoptosis remains to be studied. These results appear to have important implications for future clinical studies on TRAIL.
Resumo:
Bioelectrical impedance analysis (BIA) has been reported to be insensitive to changes in water volumes in individual subjects, This study was designed to investigate the effect on the intra- and extracellular resistances (Ri and Re) of the segments of subjects for whom body water was changed without significant change to the total amount of electrolyte in the respective fluids, Twelve healthy adult subjects were recruited. Ri and Re of the leg, trunk, and arm of the subjects were determined from BIA measures prior to commencement of two separate studies that involved intervention, resulting in a loss/gain of body water effected either bt a sauna followed by water intake (study 1) or by ingestion (study 2). Ri and Re of the segments were also determined at a number of times following these interventions, The mean change in body water, expressed as a percentage of body weight, was 0.9% in study 1 and 1.25% in study 2. For each study, the results for each subject were normalized for each limb to the initial (prestudy) value and then the normalized results for each segment were pooled for all subjects, ANOVA of these pooled results failed to demonstrate any significant differences between the normalized mean values of Ri or Re of the segments measured through the course of each study, The failure to detect a change in Ri or Re is explained in terms of the basic theory of BIA.
Resumo:
In a randomized trial involving 71 postmenopausal osteoporotic women with vertebral compression fractures, radiocalcium absorption studies using the Ca-45 single isotope method (alpha) were performed at baseline and after 8 months of treatment with either continuous combined hormone replacement therapy (HRT, as piperazine estrone sulfate 0.625-0.937mg daily +/- medroxyprogesterone acetate 2.5 mg daily depending on uterine status) or HRT plus calcitriol 0.25 mu g twice daily. A calcium supplement of 600 mg nocte was given to only those women who had a daily calcium intake of less than 1 g per day at baseline, as assessed by recalled dietary intake. There was a significant decrease 0.74 (+/- 0.35 SD) to 0.58 (+/- 0.22), Delta alpha = -0.17 (+/- 0.26), p<0.0005] in alpha at 8 months compared with baseline in the HRT-treated group, but a significant increase [0.68 (+/- 0.31) to 0.84 (+/- 0.27), Delta alpha = +0.16 (+/- 0.30), p<0.003] in the HRT-plus-calcitriol treated patients, resulting in alpha being significantly higher after 8 months in the latter group than in the HRT-only group. Although 72% of the patients had been supplemented with calcium between the first and second studies, separate analyses revealed that the change in calcium intake had not affected the result. Further breakdown of the groups into baseline 'normal' absorbers (alpha greater than or equal to 0.55) and 'malabsorbers' (alpha <0.55) revealed that alpha decreased with HRT treatment only in the normal absorbers, and remained stable in the malabsorbers. Conversely, following HRT plus calcitriol treatment, alpha increased only in the malabsorbers, the normal absorbers in this group remaining unchanged. In conclusion, our data show that HRT, of the type and dose used in this study, did not produce an increase in absorption efficiency; it was in fact associated with a fall. increased absorption efficiency cannot be achieved unless calcitriol is used concurrently, and then only in patients with malabsorption. Calcitriol also had a significant effect in normal absorbers in that it prevented the decline in alpha seen with HRT alone, and thus should be considered in all patients with postmenopausal osteoporosis treated with HRT.
Resumo:
Background: Epidemiological studies suggest that raised plasma concentrations of total homocysteine (tHcy) may be a common, causal and treatable risk factor for atherothromboembolic ischaemic stroke. Although tHcy can be lowered effectively with small doses of folic acid, vitamin B-12 and vitamin B-6, it is not known whether lowering tHcy, by means of multivitamin therapy, can prevent stroke and other major atherothromboembolic vascular events. Purpose: To determine whether vitamin supplements (folic acid 2 mg, B-6 25 Mg, B-12 500 mug) reduce the risk of stroke, and other serious vascular events, in patients with recent stroke or transient ischaemic attacks of the brain or eye (TIA). Methods: An international, multi-centre, randomised, double-blind, placebo-controlled clinical trial. Results: As of November 2001, more than 1,400 patients have been randomised from 10 countries in four continents. Conclusion: VITATOPS aims to recruit and follow up 8,000 patients between 2000 and 2004, and provide a reliable estimate of the safety and effectiveness of dietary supplementation with folic acid, vitamin B-12, and vitamin B-6 in reducing recurrent serious vascular events among a wide range of patients with TIA and stroke. Copyright (C) 2002 S. Karger AG, Basel.
Resumo:
In this paper, we propose a new nonlocal density functional theory characterization procedure, the finite wall thickness model, for nanoporous carbons, whereby heterogeneity of pore size and pore walls in the carbon is probed simultaneously. We determine the pore size distributions and pore wall thickness distributions of several commercial activated carbons and coal chars, with good correspondence with X-ray diffraction. It is shown that the conventional infinite wall thickness approach overestimates the pore size slightly. Pore-pore correlation has been shown to have a negligible effect on prediction of pore size and pore wall thickness distributions for small molecules such as argon used in characterization. By utilizing the structural parameters (pore size and pore wall thickness distribution) in the generalized adsorption isotherm (GAI) we are able to predict adsorption uptake of supercritical gases in BPL and Norit RI Extra carbons, in excellent agreement with experimental adsorption uptake data up to 60 MPa. The method offers a useful technique for probing features of the solid skeleton, hitherto studied by crystallographic methods.
Resumo:
We describe the mechanism of ribonuclease inhibition by ribonuclease inhibitor, a protein built of leucine-rich repeats, based on the crystal structure of the complex between the inhibitor and ribonuclease A. The structure was determined by molecular replacement and refined to an R(cryst) of 19.4% at 2.5 Angstrom resolution. Ribonuclease A binds to the concave region of the inhibitor protein comprising its parallel beta-sheet and loops. The inhibitor covers the ribonuclease active site and directly contacts several active-site residues. The inhibitor only partially mimics the RNase-nucleotide interaction and does not utilize the pi phosphate-binding pocket of ribonuclease A, where a sulfate ion remains bound. The 2550 Angstrom(2) of accessible surface area buried upon complex formation may be one of the major contributors to the extremely tight association (K-i = 5.9 x 10(-14) M). The interaction is predominantly electrostatic; there is a high chemical complementarity with 18 putative hydrogen bonds and salt links, but the shape complementarity is lower than in most other protein-protein complexes. Ribonuclease inhibitor changes its conformation upon complex formation; the conformational change is unusual in that it is a plastic reorganization of the entire structure without any obvious hinge and reflects the conformational flexibility of the structure of the inhibitor. There is a good agreement between the crystal structure and other biochemical studies of the interaction. The structure suggests that the conformational flexibility of RI and an unusually large contact area that compensates for a lower degree of complementarity may be the principal reasons for the ability of RI to potently inhibit diverse ribonucleases. However, the inhibition is lost with amphibian ribonucleases that have substituted most residues corresponding to inhibitor-binding residues in RNase A, and with bovine seminal ribonuclease that prevents inhibitor binding by forming a dimer. (C) 1996 Academic Press Limited
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).