51 resultados para KRAS GENE MUTATION

em University of Queensland eSpace - Australia


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Two families, originally diagnosed as having nonsyndromic X-linked mental retardation (NSXLMR), were reviewed when it was shown that they had a 24-bp duplication (428-45 1dup(24bp)) in the ARX gene [Stromme et al., 2002: Nat Genet 30:441-445]. This same duplication had also been found in three other families: one with X-linked infantile spasms and hypsarrhythmia (X-linked West syndrome, MIM 308350) and two with XLMR and dystonic movements of the hands (Partington syndrome, MIM 309510). On review, manifestations of both West and Partington syndromes were found in some individuals from both families. In addition, it was found that one individual had autism and two had autistic behavior, one of whom had epilepsy. The degree of mental retardation ranged from mild to severe. A GCG trinucleotide expansion (GCG)10+7 and a deletion of 1,517 by in the ARX gene have also been found in association with the West syndrome, and a missense mutation (1058C >T) in a family with a newly recognized form of myoclonic epilepsy, severe mental retardation, and spastic paraplegia [Scheffer et al., 2002: Neurology, in press]. Evidently all these disorders are expressions of mutations in the same gene. It remains to be seen what proportions of patients with infantile spasms, focal dystonia, autism, epilepsy, and nonsyndromic mental retardation are accounted for by mutations in the ARX gene. (C) 2002 Wiley-Liss, Inc.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Although several genes for idiopathic epilepsies from families with simple Mendelian inheritance have been found, genes for the common idiopathic generalized epilepsies, where inheritance is complex, presently are elusive. We studied a large family with epilepsy where the two main phenotypes were childhood absence epilepsy (CAE) and febrile seizures (FS), which offered a special opportunity to identify epilepsy genes. A total of 35 family members had seizures over four generations. The phenotypes comprised typical CAE (eight individuals); FS alone (15), febrile seizures plus (FS+) (three); myoclonic astatic epilepsy (two); generalized epilepsy with tonic-clonic seizures alone (one); partial epilepsy (one); and unclassified epilepsy despite evaluation (two). In three remaining individuals, no information was available. FS were inherited in an autosomal dominant fashion with 75% penetrance. The inheritance of CAE in this family was not simple Mendelian, but suggestive of complex inheritance with the involvement of at least two genes. A GABA(A) receptor gamma2 subunit gene mutation on chromosome 5 segregated with FS, FS+ and CAE, and also occurred in individuals with the other phenotypes. The clinical and molecular data suggest that the GABA(A) receptor subunit mutation alone can account for the FS phenotype. An interaction of this gene with another gene or genes is required for the CAE phenotype in this family. Linkage analysis for a putative second gene contributing to the CAE phenotype suggested possible loci on chromosomes 10, 13, 14 and 15. Examination of these loci in other absence pedigrees is warranted.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Oropharyngeal candidiasis is a common clinical problem encountered in patients with defects in innate or cell-mediated immunity. We have previously shown that recovery from chronic oropharyngeal candidiasis is dependent on CD4+ T-cell augmentation of neutrophil and macrophage candidacidal activity, and that the immune response is characterised by the production of cytokines such as IL-12 and IFN-gamma by cells in the local draining lymph nodes, and by the expression of TNF-alpha in the oral tissues. Objective: The purpose of this study was to elaborate on the role of these cytokines in recovery from oropharyngeal candidiasis, by using cytokine-specific gene-knockout mice. Methods: These mice are created by targeted gene mutation (tm1) of embryonic stem (ES) cells microinjected into host embryos. IL-4, IL-10, IL-12, IFN-gamma and TNF-alpha knockout mice, and appropriate controls, were infected orally with 108 viable C. albicans yeasts. The infection was quantified by swabbing the oral cavity and plating on Sabouraud's agar. Results: Tnftm1mice developed an acute severe infection characterized by an increased fungal load in the early stages of infection, but cleared the yeast within the same time frame as control mice (21 days). On the other hand, Il12btm1 mice developed a chronic oropharyngeal infection (120 days) similar to that seen in T-cell deficient (Foxn1nu/Foxn1nu) mutant mice. There was no significant difference between Il4tm1, Il10tm1, and Ifngtm1 mice and their respective controls. Conclusions: Tnftm1 mice may be rendered more susceptible through impaired recruitment of phagocytic cells, and/or impaired killing of C. albicans, whereas Il12btm1 mice may not be capable of activating naïve T-cells or inducing an appropriate cellular immune response. Supported by NHMRC and ADRF.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Background & Aims: Nonalcoholic steatohepatitis (NASH) is a chronic liver disease that occasionally progresses to cirrhosis but usually has a benign course. The aim of this study was to investigate the role of the hemochromatosis mutation Cys282Tyr in development of the mild hepatic iron overload found in some patients with NASH and its association with hepatic damage in these patients. Methods: Fifty-one patients with NASH were studied. The presence of the Cys282Tyr mutation was tested in all patients, and the data were analyzed with respect to the histological grade of steatosis, inflammation, Perls' staining, hepatic iron concentration (HIC), and serum iron indices. Results: Thirty-one percent of patients with NASH were either homozygous or heterozygous for the Cys282Tyr mutation. This mutation was significantly associated with Perls' stain grade (P < 0.005), HIC (P < 0.005), and transferrin saturation percentage (P < 0.005) but not with serum ferritin levels. Linear regression analysis showed that increased hepatic iron (Perls' stain or HIC) had the greatest association with the severity of fibrosis (P < 0.0001). Conclusions: The Cys282Tyr mutation is responsible for most of the mild iron overload found in NASH and thus has a significant association with hepatic damage in these patients. Heterozygosity for the hemochromatosis gene mutation therefore cannot always be considered benign.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The majority of severe epileptic encephalopathies of early childhood are symptomatic where a clear etiology is apparent. There is a small subgroup, however, where no etiology is found on imaging and metabolic studies, and genetic factors are important. Myoclonic-astatic epilepsy (MAE) and severe myoclonic epilepsy in infancy (SMEI), also known as Dravet syndrome, are epileptic encephalopathies where multiple seizure types begin in the first few years of life associated with developmental slowing. Clinical and molecular genetic studies of the families of probands with MAE and SMEI suggest a genetic basis. MAE was originally identified as part of the genetic epilepsy syndrome generalized epilepsy with febrile seizures plus (GEFS(+)). Recent clinical genetic studies suggest that SMEI forms the most severe end of the spectrum of the GEFS(+). GEF(+) has now been associated with molecular defects in three sodium channel subunit genes and a GABA subunit gene. Molecular defects of these genes have been identified in patients with MAE and SMEI. Interestingly, the molecular defects in MAE have been found in the setting of large GEFS(+) pedigrees, whereas, more severe truncation mutations arising de novo have been identified in patients with SMEI. It is likely that future molecular studies will shed light on the interaction of a number of genes, possibly related to the same or different ion channels, which result in a severe phenotype such as MAE and SMEI. (C) 2001 Elsevier Science B.V. All rights reserved.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

80.00% 80.00%

Publicador:

Resumo:

1. Improved approaches to screening and diagnosis have revealed primary aldosteronism (PAL) to be much more common than previously thought, with most patients normokalaemic. The spectrum of this disorder has been further broadened by the study of familial varieties. 2. Familial hyperaldosteronism type I (FH-I) is a glucocorticoid-remediable form of PAL caused by the inheritance of an adrenocorticotrophic hormone (ACTH)- regulated, hybrid CYP11B1/CYP11B2 gene. Diagnosis has been greatly facilitated by the advent of genetic testing. The severity of hypertension varies widely in FH-I, even among members of the same family, and has demonstrated relationships with gender, degree of biochemical disturbance and hybrid gene crossover point position. Hormone day curve studies show that the hybrid gene dominates over wild-type CYP11B2 in terms of aldosterone regulation. This may be due, in part, to a defect in wild-type CYP11B2-induced aldosterone production. Control of hypertension in FH-I requires only partial suppression of ACTH and much smaller glucocorticoid doses than previously recommended. 3. Familial hyperaldosteronism type II (FH-II) is not glucocorticoid remediable and is not associated with the hybrid gene mutation. Familial hyperaldosteronism type II is clinically, biochemically and morphologically indistinguishable from apparently non-familial PAL. Linkage studies in one informative family did not show segregation of FH-II with the CYP11B2, AT1 or MEN1 genes, but a genome-wide search has revealed linkage with a locus in chromosome 7. As has already occurred in FH-I, elucidation of causative mutations is likely to facilitate earlier detection of PAL.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Frizzled genes encode a family of Wnt ligand receptors, which have a conserved cysteine-rich Wnt binding domain and include both transmembrane and secreted forms. Work by others has shown that experimental perturbation of Wnt signaling results in aberrant hair formation, hair growth, and hair structure. To date, however, there is no information on the contribution of individual Frizzled proteins to hair development. We now report that Frizzled-3 expression in skin is restricted to the epidermis and to the developing hair follicle. Northern analysis on total mouse skin mRNA revealed a single Frizzled-3 transcript of 3.7 kb. Reverse transcription-polymerase chain reaction and in situ hybridization analysis revealed Frizzled-3 expression in epidermal and hair follicle keratinocytes. Frizzled-3 transcripts are first detected in discrete foci in the developing epidermis of 13 d embryos and later in the hair follicle placodes of 15 d embryos, suggesting a role for this Frizzled isoform in follicle development. In 17 d embryos and id old newborn mice Frizzled-3 expression is limited to suprabasal keratinocytes and is not seen in pelage follicles until 3 d postpartum. In 7 d old neonatal skin, Frizzled-3 is expressed throughout the epidermis and in the outer cell layers of hair follicles. We have also identified the mRNA encoding human Frizzled-3 in epidermal keratinocytes and in the HaCaT keratinocyte cell line. Human Frizzled-3 mRNA encodes a 666 amino acid protein with 97.8% identity to the mouse protein. The human Frizzled-3 gene was mapped using a radiation-hybrid cell line panel to the short arm of chromosome 8 between the markers WI-1172 and WI-8496 near the loci for the Hypotrichosis of Marie Unna and Hairless genes.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Ataxia-telangiectasia (A-T) is characterised by hypersensitivity to ionising radiation (IR), immunodeficiency, neurodegeneration and predisposition to malignancy. Mutations in the A-T gene (ATM) often result in reduced levels of ATM protein and/or compromise ATM function. IR induced DNA damage is known to rapidly upregulate ATM kinase activity/phosphorylation events in the control of cell cycle progression and other processes. Variable expression of ATM levels in different tissues and its upregulation during cellular proliferation indicate that the level of ATM is also regulated by mechanisms other than gene mutation. Here, we report on the IR induction of ATM protein levels within a number of different cell types and tissues. Induction had begun within 5 min and peaked within 2 h of exposure to 2 Gy of IR, suggesting a rapid post-translational mechanism. Low basal levels of ATM protein were more responsive to IR induction compared to high ATM levels in the same cell type. Irradiation of fresh skin biopsies led to an average three-fold increase in ATM levels while immunohistochemical analyses indicated low expressing cells within the basal layer with ten-fold increases in ATM levels following IR. ATM high expressing lymphoblastoid cell lines (LCLs) which were initially resistant to the radiation-induction of ATM levels also became responsive to IR after ATM antisense expression was used to reduce the basal levels of the protein. These results demonstrate that ATM is present in variable amounts in different tissue/cell types and where basal levels are low ATM levels can be rapidly induced by IR to saturable levels specific for different cell types. ATM radiation-induction is a sensitive and rapid radioprotective response that complements the IR mediated activation of ATM.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Canine copper toxicosis is an important inherited disease in Bedlington terriers, because of its high prevalence rate and similarity to human copper storage disease. It can lead to chronic liver disease and occasional haemolytic anaemia due to impaired copper excretion. The responsible gene for copper toxicosis in Bedlington terriers has been recently identified and was found not to be related to human Wilson's disease gene ATP7B. Although our understanding of copper metabolism in mammals has improved through genetic molecular technology, the diversity of gene mutation related to copper metabolism in animals will help identify the responsible genes for non-Wilsonian copper toxicoses in human. This review paper discusses our knowledge of normal copper metabolism and the pathogenesis, molecular genetics and current research into copper toxicosis in Bedlington terriers, other animals and humans. (C) 2004 Elsevier GmbH. All rights reserved.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

This manuscript provides a summary of the results presented at a symposium organized to accumulate information on factors that influence the prevalence of acaricide resistance and tick-borne diseases. This symposium was part of the 19th International Conference of the World Association for the Advancement of Veterinary Parasitology (WAAVP), held in New Orleans, LA, USA, during August 10-14, 2003. Populations of southern cattle ticks, Boophilus microplus, from Mexico have developed resistance to many classes of acaricide including chlorinated hydrocarbons (DDT), pyrethroids, organ ophosphates, and formamidines (amitraz). Target site mutations are the most common resistance mechanism observed, but there are examples of metabolic mechanisms. In many pyrethroid resistant strains, a single target site mutation on the Na+ channel confers very high resistance (resistance ratios: >1000x) to both DDT and all pyrethroid acaricides. Acetylcholine esterase affinity for OPs is changed in resistant tick populations. A second mechanism of OP resistance is linked to cytochrome P450 monooxygenase activity. A PCR-based assay to detect a specific sodium channel gene mutation that is associated with resistance to permethrin has been developed. This assay can be performed on individual ticks at any life stage with results available in a few hours. A number of Mexican strains of B. microplus with varying profiles of pesticide resistance have been genotyped using this test. Additionally, a specific metabolic esterase with permethrin-hydrolyzing activity, CzEst9, has been purified and its gene coding region cloned. This esterase has been associated with high resistance to permethrin in one Mexican tick population. Work is continuing to clone specific acetylcholinesterase (AChE) and carboxylesterase genes that appear to be involved in resistance to organophosphates. Our ultimate goal is the design of a battery of DNA- or ELISA-based assays capable of rapidly genotyping individual ticks to obtain a comprehensive profile of their susceptibility to various pesticides. More outbreaks of clinical bovine babesisois and anaplasmosis have been associated with the presence of synthetic pyrethroid (SP) resistance when compared to OP and amidine resistance. This may be the result of differences in the temporal and geographic patterns of resistance development to the different acaricides. If acaricide resistance develops slowly, herd immunity may not be affected. The use of pesticides for the control of pests of cattle other than ticks can affect the incidence of tick resistance and tick-borne diseases. Simple analytical models of tick- and tsetse-bome diseases suggest that reducing the abundance of ticks, by treating cattle with pyrethroids for example, can have a variety of effects on tick-bome diseases. In the worst-case scenario, the models suggest that treating cattle might not only have no impact on trypanosomosis but could increase the incidence of tick-bome disease. In the best-case, treatment could reduce the incidence of both trypanosomosis and tick-bome diseases Surveys of beef and dairy properties in Queensland for which tick resistance to amitraz was known were intended to provide a clear understanding of the economic and management consequences resistance had on their properties. Farmers continued to use amitraz as the major acaricide for tick control after the diagnosis of resistance, although it was supplemented with moxidectin (dairy farms) or fluazuron, macrocyclic lactones or cypermethrin/ chlorfenvinphos. (C) 2004 Published by Elsevier B.V.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Metaplastic breast carcinomas are reported to harbour epidermal growth factor receptor (EGFR) overexpression in up to 80% of the cases, but EGFR gene amplification is the underlying genetic mechanism in around one-third of these. In this study, EGFR gene amplification as defined by chromogenic in situ hybridization and protein overexpression was examined in a cohort of 47 metaplastic breast carcinomas. Furthermore, the presence of activating EGFR mutations in exons 18, 19, 20, and 21 was investigated. Thirty-two cases showed EGFR overexpression and of these, 11 (34%) harboured EGFR gene amplification. In addition, EGFR amplification showed a statistically significant association with EGFR overexpression (p < 0.0094) and was restricted to carcinomas with homologous metaplasia. Ten cases, five with and five without EGFR amplification, were subjected to microarray-based CGH, which demonstrated that EGFR copy number gain may occur by amplification of a discrete genomic region or by gains of the short arm of chromosome 7 with a breakpoint near the EGFR gene locus, the minimal region of amplification mapping to EGFR, LANCL2, and SECOG. No activating EGFR mutations were identified, suggesting that this is unlikely to be a common alternative underlying genetic mechanism for EGFR expression in metaplastic breast carcinomas. Given that metaplastic breast carcinomas are resistant to conventional chemotherapy or hormone therapy regimens and that tumours with EGFR amplification are reported to be sensitive to EGFR tyrosine kinase inhibitors, these findings indicate that further studies are warranted to explore EGFR tyrosine kinase inhibitors as potential therapeutic agents for metaplastic breast carcinomas harbouring amplification of 7p11.2. Copyright (c) 2006 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Background-Marfan syndrome (MFS), a condition caused by fibrillin-1 gene mutation is associated with aortic aneurysm that shows elastic lamellae disruption, accumulation of glycosaminoglycans, and vascular smooth muscle cell (VSMC) apoptosis with minimal inflammatory response. We examined aneurysm tissue and cultured cells for expression of transforming growth factor-beta1 to -beta3 (TGF beta 1 to 3), hyaluronan content, apoptosis, markers of cell migration, and infiltration of vascular progenitor cells (CD34). Methods and Results-MFS aortic aneurysm (6 males, 5 females; age 8 to 78 years) and normal aorta (5 males, 3 females; age 22 to 56 years) were used. Immunohistochemistry showed increased expression of TGF beta 1 to 3, hyaluronan, and CD34-positive microcapillaries in MFS aneurysm compared with control. There was increased expression of TGF beta 1 to 3 and hyaluronan in MFS cultured VSMCs, adventitial fibroblasts (AF), and skin fibroblasts (SF). Apoptosis was increased in MFS (VSMC: mean cell loss in MFS 29%, n of subjects = 5, versus control 8%, n = 3, P < 0.05; AF: 28%, n = 5 versus 7%, n = 5, P < 0.05; SF: 29%, n = 3 versus 4%, n = 3, not significant). In MFS, there was a 2-fold increase in adventitial microcapillaries containing CD34-positive cells compared with control tissue. Scratch wound assay showed absence of CD44, MT1-MMP, and beta-3 integrin at the leading edge of migration in MFS indicating altered directional migration. Western blot showed increased expression of TGF beta 1 to 3 in MFS but no change in expression of CD44, MT1-MMP, or beta-3 integrin compared with controls. Conclusions-There was overexpression of TGF-beta in MFS associated with altered hyaluronan synthesis, increased apoptosis, impaired progenitor cell recruitment, and abnormal directional migration. These factors limit tissue repair and are likely to contribute to aneurysm development.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Primary aldosteronism (PAL) is caused by the autonomous over-production of aldosterone. Once thought rare, it is now reported to be responsible for 5–10% of hypertension. Familial hyperaldosteronism type II (FH-II), unlike familial hyperaldosteronism type I, is not glucocorticoid-remediable and not associated with the hybrid CYP11B1/CYP11B2 gene mutation. At least five times more common than FH-I, FH-II is clinically, biochemically and morphologically indistinguishable from apparently sporadic PAL, suggesting that its incidence maybe even higher. Studies performed in collaboration with C Stratakis (NIH, Bethesda) on our largest Australian FH-II family (eight affected members) demonstrated linkage at chromosome 7p22. Similar linkage at this region was also found in a South American FH-II family (DNA provided by MI New, Presbyterian Hospital, New York). Mutations in the exons and intron/exon boundaries of the PRKARIB gene (which resides at 7p22 and is closely related to PRKARIA gene mutated in Carney complex) have been excluded in our largest Australian FH-II family. Using more finely spaced markers, we have confirmed linkage at 7p22 in these 2 families, and identified a second Australian family with evidence of linkage at this locus. The combined multipoint LOD score for these 3 families is 4.87 (θ=0) with markers D7S462 and D7S2424, which exceeds the critical threshold for genome-wide significance suggested by Lander and Kruglyak (1995), providing strong support for this locus harbouring mutations responsible for FH-II. A newly identified recombination event in our largest Australian family has narrowed the region of linkage by 1.8 Mb, permitting exclusion of approximately half the genes residing in the original reported 5Mb linked locus. In addition, we have strongly excluded linkage to these key markers in two Australian families (maximum multipoint LOD scores −3.51 and −2.77), supporting the notion that FH-II may be genetically heterogeneous. In order to identify candidate genes at 7p22, more closely spaced markers will be used to refine the locus, as well as single nucleotide polymorphism analysis.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Once thought rare, primary aldosteronism (PAL) is now reported to be responsible for 5–10% of hypertension. Unlike familial hyperaldosteronism type I (FH-I), FH-II is not glucocorticoidremediable and not associated with the hybrid CYP11B1/CYP11B2 gene mutation. At least five times more common than FH-I, FH-II is clinically indistinguishable from apparently sporadic PAL, suggesting an even higher incidence. Studies performed in collaboration with C Stratakis (NIH, Bethesda) on our largest Australian family (eight affected members) demonstrated linkage at chromosome 7p22. Linkage at this region was also found in a South American family (DNA provided by MI New, Mount Sinai School of Medicine, New York) and in a second Australian family. The combined multipoint LOD score for these 3 families is 4.61 (q = 0) with markers D7S462 and D7S517, providing strong support for this locus harbouring mutations responsible for FH-II. A newly identified recombination event in our largest Australian family has narrowed the region of linkage by 1.8 Mb, permitting exclusion of approximately half the genes residing in the originally reported 5 Mb linked locus. Candidate genes that are involved in cell cycle control are of interest as adrenal hyperplasia and adrenal adenomas are common in FH-II patients. A novel candidate gene in this linked region produces the retinoblastoma-associated Kruppel-associated box protein (RBaK) which interacts with the retinoblastoma gene product to repress the expression of genes activated by members of the E2F family of transcription factors.