neptune, a Kruppel-like transcription factor that participates in primitive erythropoiesis in Xenopus

The specification of the erythroid lineage from hematopoietic stem cells requires the expression and activity of lineage-specific transcription factors. One transcription factor family that has several members involved in hematopoiesis is the Kruppel-like factor (KLF) family [1]. For example, erythroid KLF (EKLF) regulates beta -globin expression during erythroid differentiation [2-6]. KLFs share a highly conserved zinc finger-based DNA binding domain (DBD) that mediates binding to CACCC-box and GC-rich sites, both of which are frequently found in the promoters of hematopoietic genes. Here, we identified a novel Xenopus KLF gene, neptune, which is highly expressed in the ventral blood island (VBI), cranial ganglia, and hatching and cement glands. neptune expression is induced in response to components of the BMP-4 signaling pathway in injected animal cap explants. Similar to its family member, EKLF, Neptune can bind CACCC-box and GC-rich DNA elements. We show that Neptune cooperates with the hematopoietic transcription factor XGATA-1 to enhance globin induction in animal cap explants. A fusion protein comprised of Neptune's DBD and the Drosophila engrailed repressor domain suppresses the induction of globin in ventral marginal zones and in animal caps. These studies demonstrate that Neptune is a positive regulator of primitive erythropoiesis in Xenopus.

Phytophthora sojae avirulence genes Avr4 and Avr6 are located in a 24kb, recombination-rich region of genomic DNA

A cross between two different races (race 7 x race 25) of the soybean root and stem rot pathogen Phytophthora sojae was analyzed to characterize the genomic region flanking two cosegregating avirulence genes, Anur4 and Anur6. Both genes cosegregated in the ratio of 82:17 (avirulent:virulent) in an F-2 population, suggestive of a single locus controlling both phenotypes. A chromosome walk was commenced from RAPD marker OPE7.1C, 2.0 cM distant from the Anur4/6 locus. Three overlapping cosmids were isolated which included genetic markers that flank the Anur4/6 locus. The chromosome walk spanned a physical distance of 67 kb which represented a genetic map distance of 22.3cM, an average recombination frequency of 3.0kb/cM and 11.7-fold greater than the predicted average recombination frequency of 35.3 kb/cM for the entire P. sojae genome. Six genes (cDNA clones) expressed from the Anur4/6 genomic region encompassed by the cosmid contig were identified. Single nucleotide polymorphisms and restriction fragment length polymorphisms showed these six genes were closely linked to the Anur4/6 locus. Physical mapping of the cDNA clones within the cosmid contig made it possible to deduce the precise linkage order of the cDNAs. None of the six cDNA clones appear to be candidates for Anur4/6. We conclude that two of these cDNA clones flank a physical region of approximately 24 kb and 4.3 cM that appears to include the Anur4/6 locus. (C) 2003 Elsevier Inc. All rights reserved.

Inhibition of phenotype modulation, growth, and migration of vascular smooth muscle cells by a guanosine-rich 30-mer phosphorothioate oligodeoxynucleotide

The testing of a 30-mer dG-rich phosphorothioate oligodeoxynucleotide (LG4PS) for effects on the behaviour of vascular smooth muscle cells (VSMC) in vitro and in vivo is described. LG4PS at 0.3 mu M inhibited significantly the phenotype modulation of freshly isolated rabbit VSMC, and cell outgrowth from pig aortic explants was inhibited similar to 80% by 5 mu M LG4PS. The growth of proliferating rabbit and pig VSMC was inhibited similar to 70% by 0.3 mu M and 5 mu M LG4PS, respectively. Though less marked, the antiproliferative effects of LG4PS on human VSMC were comparable to those obtained with heparin. The cytotoxic effects of LG4PS on VSMC in vitro were low. Despite these promising results, adventitial application of 2-200 nmol LG4PS in pluronic gel failed to reduce vascular hyperplasia in balloon-injured rabbit carotid arteries, and the highest dose caused extensive mortality. (C) 1997 Academic Press Limited.

Characterization of an ATP-dependent pathway of activation for the heterocyclic amine carcinogen N-hydroxy-2-amino-3-methylimidazo[4,5-f]quinoline

2-Amino-3-methylimidazo[4,5-f]quinoline (IQ) is one of several mutagenic and carcinogenic heterocyclic amines formed during the cooking process of protein-rich foods, These compounds are highly mutagenic and have been shown to produce tumours in various tissues in rodents and non-human primates. Metabolic activation of IQ is a two-step process involving N-hydroxylation by CYP1A2 followed by esterification to a more reactive species capable of forming adducts with DNA, To date, acetylation and sulphation have been proposed as important pathways in the formation of N-hydroxy esters, In this study we have demonstrated the presence of an ATP-dependent activation pathway for N-hydroxy-IQ (N-OH-IQ) leading to DNA adduct formation measured by covalent binding of [H-3]N-OH-IQ to DNA, ATP-dependent DNA binding of N-OH-IQ was greatest in the cytosolic fraction of rat liver, although significant activity was also seen in colon, pancreas and lung. ATP was able to activate N-OH-IQ almost 10 times faster than N-hydroxy-2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (7.7 +/- 0.3 and 0.9 +/- 0.1 pmol/mg protein/min, respectively). Using reported intracellular concentrations of cofactor, the ability of ATP to support DNA binding was similar to that seen with 3'-phosphoadenosine 5'-phosphosulphate and similar to 50% of that seen with acetyl coenzyme A (AcCoA), In addition to DNA binding, HPLC analysis of the reaction mixtures using ATP as co-factor showed the presence of two stable, polar metabolites, With AcCoA, only one metabolite was seen. The kinase inhibitors genistein, tyrphostin A25 and rottlerin significantly inhibited both DNA binding and metabolite formation with ATP. However, inhibition was unlikely to be due to effects on enzyme activity since the broad spectrum kinase inhibitor staurosporine had no effect and the inactive analogue of genistein, daidzein, was as potent as genistein, The effects of genistein and daidzein, which are naturally occurring isoflavones from soy and other food products, on DNA adduct formation may potentially be useful in the prevention of heterocyclic amine-induced carcinogenesis.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Complete DNA sequence and gene organization of the mitochondrial genome of the liverfluke, Fasciola hepatica L. (Platyhelminthes; Trematoda)

The complete nucleotide sequence of the mitochondrial (mt) DNA molecule of the liverfluke, Fasciola hepatica (phylum Platyhelminthes, class Trematoda, family Fasciolidae), was determined, It comprises 14462 bp, contains 12 protein-encoding, 2 ribosomal and 22 transfer RNA genes, and is the second complete flatworm (and the first trematode) mitochondrial sequence to be described in detail. All of the genes are transcribed from the same strand. Of the genes typically found in mitochondrial genomes of eumetazoans, only atp8 is absent. The nad4L and nad4 genes overlap by 40 nt. Most intergenic sequences are very short. Two larger non-coding regions are present. The longer one (817 nt) is located between trnG and cox3 and consists of 8 identical tandem repeats of 85 nt, rich in G and C, followed by 1 imperfect repeat. The shorter non-coding region (187 nt) exhibits no special features and is separated from the longer region by trnG. The gene arrangement resembles that of some other trematodes including the eastern Asian Schistosoma species (and cyclophyllidean cestode species) but it is strikingly different from that of the African schistosomes, represented by Schistosoma mansoni. The genetic code is as inferred previously for flatworms. Transfer RNA genes range in length from 58 to 70 nt, their products producing characteristic 'clover leaf' structures, except for tRNA(S-VON) and tRNA(S-AGN) lacking the DHU arm.

Autosomal dominant hypocalcemia: A novel activating mutation (E604K) in the cysteine-rich domain of the calcium-sensing receptor

We report a novel activating mutation (E604K) of the calcium-sensing receptor in a family with autosomal dominant hypocalcemia. Whereas all affected individuals exhibited marked hypocalcemia, some cases with untreated hypocalcemia exhibited seizures in infancy, whereas others were largely asymptomatic from birth into adulthood. The missense mutation E604K (G2182A, GenBank accession no. U20759), which affects an amino acid residue in the C terminus of the cysteine-rich domain of the extracellular head, co-segregated with hypocalcemia in all seven individuals for whom DNA was available. Two unaffected, normocalcemic members of the family did not exhibit the mutation. The molecular impact of the mutation on two key components of the signaling response was assessed in HEK-293 cells transiently transfected with cDNA corresponding to either the wild-type calcium-sensing receptor or the E604K mutation derived by site-directed mutagenesis. There was a significant leftward shift in the concentration response curves for the effects of extracellular Ca2+ on both intracellular Ca2+ mobilization (determined by aequorin luminescence) and MAPK activity (determined by luciferase expression). The C terminus of the cysteine-rich domain of the extracellular head may normally act to suppress receptor activity in the presence of low extracellular Ca2+ concentrations.

The molecular basis for the lack of immunostimulatory activity of vertebrate DNA

Macrophages and B cells are activated by unmethylated CpG-containing sequences in bacterial DNA. The lack of activity of self DNA has generally been attributed to CpG suppression and methylation, although the role of methylation is in doubt. The frequency of CpG in the mouse genome is 12.5% of Escherichia coli, with unmethylated CpG occurring at similar to3% the frequency of E. coli. This suppression of CpG alone is insufficient to explain the inactivity of self DNA; vertebrate DNA was inactive at 100 mug/ml, 3000 times the concentration at which E. coli DNA activity was observed. We sought to resolve why self DNA does not activate macrophages. Known active CpG motifs occurred in the mouse genome at 18% of random occurrence, similar to general CpG suppression. To examine the contribution of methylation, genomic DNAs were PCR amplified. Removal of methylation from the mouse genome revealed activity that was 23-fold lower than E. coli DNA, although there is only a 7-fold lower frequency of known active CpG motifs in the mouse genome. This discrepancy may be explained by G-rich sequences such as GGAGGGG, which potently inhibited activation and are found in greater frequency in the mouse than the E. coli genome. In summary, general CpG suppression, CpG methylation, inhibitory motifs, and saturable DNA uptake combined to explain the inactivity of self DNA. The immunostimulatory activity of DNA is determined by the frequency of unmethylated stimulatory sequences within an individual DNA strand and the ratio of stimulatory to inhibitory sequences.

An exceptionally rich complex of Sanguinicolidae von Graff, 1907 (Platyhelminthes : Trematoda) from Siganidae, Labridae and Mullidae (Teleostei : Perciformes) from the Indo-West Pacific Region

We describe an unprecedented radiation of sanguinicolid blood flukes ( Digenea: Sanguinicolidae) from two species of Labridae (Choerodon venustus and C. cauteroma), seven species of Mullidae (Mulloidichthys vanicolensis, Parupeneus barberinoides, P. barberinus, P. bifasciatus, P. cyclostomus, P. indicus and P. multifasciatus) and ten species of Siganidae (Siganus argenteus, S. corallinus, S. doliatus, S. fuscescens, S. lineatus, S. margaritiferus, S. puellus, S. punctatus, S. virgatus and S. vulpinus) from sites off Australia and Palau. The flukes were morphologically similar in having the combination of a long thread-like body, tegumental spines in lateral transverse rows, a vestigial oral sucker bearing concentric rows of fine spines, an H-shaped intestine, a cirrussac, a notch level with the male genital pore, a lateral or post-ovarian uterus, a uterine chamber and separate genital pores. These species are divided into two genera on the basis of testis number. Sanguinicolids from Siganus fuscescens have a single large testis between the intestinal bifurcation and the ovary and are placed in Ankistromeces Nolan & Cribb, 2004. Species from the remaining nine species of Siganidae, Labridae and Mullidae are placed in Phthinomita n. g.; these species have two testes, the anterior testis being large and between the intestinal bifurcation and the ovary whereas the small posterior testis is at the posterior end of the body and appears rudimentary or degenerate and probably non-functional. The second internal transcribed spacer (ITS2) of ribosomal DNA ( rDNA) from 29 host/parasite/location combinations (h/p/l) was sequenced together with that of Ankistromeces mariae Nolan & Cribb, 2004 for comparison. From 135 samples we found 19 distinct genotypes which were interpreted as representing at least that many species. Replicate sequences were obtained for 25 of 30 h/p/l combinations ( including A. mariae); there was no intraspecific variation between replicates sequences for any of these. Interspecific variation ranged from 1 - 41 base differences (0.3 - 12.7% sequence divergence). The 19 putative species were difficult to recognise by morphological examination. We describe 13 new species; we do not describe (= name) six species characterised solely by molecular sequences and three putative species for which morphological data is available but for which molecular data is not. We have neither morphological nor molecular data for sanguinicolids harboured in five hosts species ( Siganus margaritiferus, S. puellus, Choerodon cauteroma, Parupeneus indicus and P. multifasciatus) in which we have seen infections. Where host species were infected in different localities they almost always harboured distinct species. Some host species ( for example, S. argenteus and S. lineatus from Lizard Island) harboured two or three species in a single geographical location. This suggests that, for parts of this system, parasite speciation has outstripped host speciation. Distance analysis of ITS2 showed species from each host family ( Siganidae, Mullidae and Labridae) did not form monophyletic clades to the exclusion of species from other host families. However, a host defined clade was formed by the sequences from sanguinicolids from S. fuscescens.

DNA Motifs Suppressing TLR9 Responses

Immune cells respond to bacterial DNA containing unmethylated CpG motifs via Toll-like receptor 9 (TLR9). Given the apparent role of TLR9 in development of systemic lupus erythernatosus (SLE), there is interest in the development of TLR9 inhibitors. TLR9-mediated responses are reported to be inhibited by a confusing variety of different DNA sequences and structures. To aid characterization, we have provisionally categorized TLR9-inhibitory oligodeoxynucleoti des (ODN) into 4 classes, on the basis of sequence and probable mode of action. Class I are short G-rich ODN, which show sequence-specific inhibition of all TLR9 responses, and may be direct competitive inhibitors for DNA binding to TLR9. Class II are telomeric repeat motifs that inhibit STAT signaling, and thus are not specific to TLR9 responses. Because Class II ODN are generally made as 24-base phosphorothioate-modified ODN (PS-ODN), they also fall into Class IV, defined as long PS-ODN, which inhibit TLR9 responses in a sequence-nonspecific manner. Class III includes oligo (dG) that forms a 4-stranded structure and inhibits DNA uptake. The Class I G-rich motifs show the most promise as selective and potent TLR9 inhibitors for therapeutic applications.

Rich task implementation: modernism meets postmodernism

School renewal', 'productive pedagogies', 'rich tasks', 'New Basics', 'key learning areas'--these are some of the discourses of change in selected Queensland schools. This paper will report on teaching as an insider/outsider in a school's Health and Physical Education department during a time of intense pressure for structural, curriculum and pedagogical shifts. As a teacher/researcher, I spent ten weeks in a government secondary school attempting to implement rich tasks as well as collect data using formal and informal interviews, field note, and document analyses, with a focus upon teachers', students' and administrators' sense of change processes and outcomes. It is suggested that the processes of, and barriers to, curriculum change in this context are best explained in terms of tensions between modernist and postmodernist phenomena.

Unlocking hidden genomic sequence

Despite the success of conventional Sanger sequencing, significant regions of many genomes still present major obstacles to sequencing. Here we propose a novel approach with the potential to alleviate a wide range of sequencing difficulties. The technique involves extracting target DNA sequence from variants generated by introduction of random mutations. The introduction of mutations does not destroy original sequence information, but distributes it amongst multiple variants. Some of these variants lack problematic features of the target and are more amenable to conventional sequencing. The technique has been successfully demonstrated with mutation levels up to an average 18% base substitution and has been used to read previously intractable poly(A), AT-rich and GC-rich motifs.

Specific PCR based detection of Phytophthora medicaginis using the intergenic spacer region of the ribosomal DNA

A technique based on the polymerase chain reaction (PCR) for the specific detection of Phytophthora medicaginis was developed using nucleotide sequence information of the ribosomal DNA (rDNA) regions. The complete IGS 2 region between the 5 S gene of one rDNA repeat and the small subunit of the adjacent repeat was sequenced for P. medicaginis and related species. The entire nucleotide sequence length of the IGS 2 of P. medicaginis was 3566 bp. A pair of oligonucleotide primers (PPED04 and PPED05), which allowed amplification of a specific fragment (364 bp) within the IGS 2 of P. medicaginis using the PCR, was designed. Specific amplification of this fragment from P. medicaginis was highly sensitive, detecting template DNA as low as 4 ng and in a host-pathogen DNA ratio of 1000000:1. Specific PCR amplification using PPED04 and PPED05 was successful in detecting P. medicaginis in lucerne stems infected under glasshouse conditions and field infected lucerne roots. The procedures developed in this work have application to improved identification and detection of a wide range of Phytophthora spp. in plants and soil.

Calcium is essential for the structural integrity of the cysteine-rich, ligand-binding repeat of the low-density lipoprotein receptor

Seven cysteine-rich repeats form the ligand-binding region of the low-density lipoprotein (LDL) receptor. Each of these repeats is assumed to bind a calcium ion, which is needed for association of the receptor with its ligands, LDL and beta-VLDL. The effects of metal ions on the folding of the reduced N-terminal cysteine-rich repeat have been examined by using reverse-phase high-performance liquid chromatography to follow the formation of fully oxidized isomers with different disulfide connectivities. in the absence of calcium many of the 15 possible isomers formed on oxidation, whereas in its presence the predominant product at equilibrium had the native disulfide bond connectivities. Other metals were far less effective at directing disulfide bond formation: Mn2+ partly mimicked the action of Ca2+, but Ba2+, Sr2+, and Mg2+ had little effect. This metal-ion specificity was also observed in two-dimensional H-1 NMR spectral studies: only Ca2+ induced the native three-dimensional fold. The two paramagnetic ions, Gd3+ and Mn2+, and Cd2+ did not promote adoption of a well-defined structure, and the two paramagnetic ions did not displace calcium ions. The location of calcium ion binding sites in the repeat was also explored by NMR spectroscopy. The absence of chemical shift changes for the side chain proton resonances of Asp26, Asp36, and Glu37 from pH 3.9 to 6.8 in the presence of calcium ions and their proximal location in the NMR structures implicated these side chains as calcium ligands. Deuterium exchange NMR experiments also revealed a network of hydrogen bonds that stabilizes the putative calcium-binding loop.