Development of ligase-assisted spacer addition for the measurement of microsatellites

Conventional methods for detecting differences in microsatellite repeat lengths rely on electrophoretic fractionation on long denaturing polyacrylamide gels, a time-consuming and labor-intensive method. Therefore, there is a need for the development of new and rapid approaches to routinely detect such length polymorphisms. The advent of techniques allowing the coupling of DNA molecules to solid surfaces has provided new prospects in the area of mutation. We describe here the development and optimization of the ligase-assisted spacer addition (LASA) method, a novel and rapid procedure based on an ELISA format to measure microsatellite repeat lengths. The LASA assay was successfully applied to a set of 11 bird samples to assess its capability as a genotyping method.

Healthy ageing - Adults with intellectual disabilities: Physical health issues

This report has been prepared by the Ageing Special Interest Research Group of the International Association for the Scientific Study of Intellectual Disabilities (IASSID) in collaboration with the Department of Mental Health and Substance Dependence and the Programme on Ageing and Health, World Health Organization (WHO), Geneva, Switzerland, and all rights are reserved by the above mentioned organization. The document may, however, be freely reviewed, abstracted, reproduced or translated in part, but not for sale or use in conjunction with commercial purposes. It may also be reproduced in full by non-commercial entities for information or for educational purposes with prior permission from WHO/IASSID. The document is likely to be available in other languages also.

FRA10B structure reveals common elements in repeat expansion and chromosomal fragile site genesis

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

X-linked myoclonic epilepsy with spasticity and intellectual disability - Mutation in the homeobox gene ARX

Objective: To describe a new syndrome of X-linked myoclonic epilepsy with generalized spasticity and intellectual disability (XMESID) and identify the gene defect underlying this disorder. Methods: The authors studied a family in which six boys over two generations had intractable seizures using a validated seizure questionnaire, clinical examination, and EEG studies. Previous records and investigations were obtained. Information on seizure disorders was obtained on 271 members of the extended family. Molecular genetic analysis included linkage studies and mutational analysis using a positional candidate gene approach. Results: All six affected boys had myoclonic seizures and TCS; two had infantile spasms, but only one had hypsarrhythmia. EEG studies show diffuse background slowing with slow generalized spike wave activity. All affected boys had moderate to profound intellectual disability. Hyperreflexia was observed in obligate carrier women. A late-onset progressive spastic ataxia in the matriarch raises the possibility of late clinical manifestations in obligate carriers. The disorder was mapped to Xp11.2-22.2 with a maximum lod score of 1.8. As recently reported, a missense mutation (1058C>T/P353L) was identified within the homeodomain of the novel human Aristaless related homeobox gene (ARX). Conclusions: XMESID is a rare X-linked recessive myoclonic epilepsy with spasticity and intellectual disability in boys. Hyperreflexia is found in carrier women. XMESID is associated with a missense mutation in ARX. This disorder is allelic with X-linked infantile spasms (ISSX; MIM 308350) where polyalanine tract expansions are the commonly observed molecular defect. Mutations of ARX are associated with a wide range of phenotypes; functional studies in the future may lend insights to the neurobiology of myoclonic seizures and infantile spasms.

Folate-sensitive fragile site FRA10A is due to an expansion of a CGG repeat in a novel gene, FRA10AC1, encoding a nuclear protein

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Dietary patterns and metabolic syndrome - a review of epidemiologic evidence

Metabolic syndrome is associated with increased risk of coronary heart disease and type 2 diabetes, and appears to be widely prevalent in both developed and developing countries. While lifestyle modification is recommended for management of the syndrome, the dietary pattern most beneficial for patients is yet to be ascertained. Original research papers from the Medline database were examined for dietary patterns that may be associated with the syndrome. Three large-scale epidemiological studies were found fitting our criteria. Dietary patterns high in fruit and vegetable content were generally found to be associated with lower prevalence of metabolic syndrome. Diet patterns with high meat intake were frequently associated with components of metabolic syndrome, particularly impaired glucose tolerance. High dairy intake was generally associated with reduced risk for components of metabolic syndrome with some inconsistency in the literature regarding risk of obesity. Minimally processed cereals appeared to be associated with decreased risk of metabolic syndrome, while highly processed cereals with high glycaemic index are associated with higher risk. Fried foods were noticeably absent from any dietary pattern associated with decreased prevalence of metabolic syndrome. The conclusion of this review is that no individual dietary component could be considered wholly responsible for the association of diet with metabolic syndrome. Rather it is the overall quality of the diet that appears to offer protection against lifestyle disease such as metabolic syndrome. Further research is required into conditions, such as overweight and obesity, which may influence the effect of diet on the development of metabolic syndrome.

Non-coding RNAs in the nervous system

Increasing evidence suggests that the development and function of the nervous system is heavily dependent on RNA editing and the intricate spatiotemporal expression of a wide repertoire of non-coding RNAs, including micro RNAs, small nucleolar RNAs and longer non-coding RNAs. Non-coding RNAs may provide the key to understanding the multi-tiered links between neural development, nervous system function, and neurological diseases.

X-linked neonatal diabetes mellitus, enteropathy and endocrinopathy syndrome is the human equivalent of mouse scurfy

To determine whether human X-linked neonatal diabetes mellitus, enteropathy and endocrinopathy syndrome (IPEX; MIM 304930) is the genetic equivalent of the scurfy (sf) mouse, we sequenced the human ortholog (FOXP3) of the gene mutated in scurfy mice (Foxp3), in IPEX patients. We found four non-polymorphic mutations. Each mutation affects the forkhead/winged-helix domain of the scurfin protein, indicating that the mutations may disrupt critical DNA interactions.

Cardiac syndrome X: relevance of arterial pressure waveform analysis to patients with chest pain and normal coronary arteries

We report the case study of a 68-year-old female with cardiac syndrome X presenting with abnormal pressure waveforms and a hypertensive response to exercise with ST-segment depression. After amlodipine treatment, pressure waveform morphology was significantly improved, exercise testing was normal and symptoms had resolved. This case emphasizes the potential clinical value of arterial waveform analysis.

Infantile spasms, dystonia, and other X-linked phenotypes caused by mutations in Aristaless related homeobox gene, ARX

Clinical data from 50 mentally retarded (MR) males in nine X-linked MR families, syndromic and non-specific, with mutations (duplication, expansion, missense, and deletion mutations) in the Aristaless related homeobox gene, ARX, were analysed. Seizures were observed with all mutations and occurred in 29 patients, including one family with a novel myoclonic epilepsy syndrome associated with the missense mutation. Seventeen patients had infantile spasms. Other phenotypes included mild to moderate MR alone, or with combinations of dystonia, ataxia or autism. These data suggest that mutations in the ARX gene are important causes of MR, often associated with diverse neurological manifestations. (C) 2002 Elsevier Science B.V. All rights reserved.

Mutations in the human ortholog of Aristaless cause X-linked mental retardation and epilepsy

Mental retardation and epilepsy often occur together. They are both heterogeneous conditions with acquired and genetic causes. Where causes are primarily genetic, major advances have been made in unraveling their molecular basis. The human X chromosome alone is estimated to harbor more than 100 genes that, when mutated, cause mental retardation(1). At least eight autosomal genes involved in idiopathic epilepsy have been identified(2), and many more have been implicated in conditions where epilepsy is a feature. We have identified mutations in an X chromosome-linked, Aristaless-related, homeobox gene (ARX), in nine families with mental retardation (syndromic and nonspecific), various forms of epilepsy, including infantile spasms and myoclonic seizures, and dystonia. Two recurrent mutations, present in seven families, result in expansion of polyalanine tracts of the ARX protein. These probably cause protein aggregation, similar to other polyalanine(3) and polyglutamine(4) disorders. In addition, we have identified a missense mutation within the ARX homeodomain and a truncation mutation. Thus, it would seem that mutation of ARX is a major contributor to X-linked mental retardation and epilepsy.

Alterations of neocortical pyramidal cell phenotype in the Ts65Dn mouse model of Down syndrome: Effects of environmental enrichment

Mental retardation in individuals with Down syndrome (DS) is thought to result from anomalous development and function of the brain; however, the underlying neuropathological processes have yet to be determined. Early implementation of special care programs result in limited, and temporary, cognitive improvements in DS individuals. In the present study, we investigated the possible neural correlates of these limited improvements. More specifically, we studied cortical pyramidal cells in the frontal cortex of Ts65Dn mice, a partial trisomy of murine chromosome 16 (MMU16) model characterized by cognitive deficits, hyperactivity, behavioral disruption and reduced attention levels similar to those observed in DS, and their control littermates. Animals were raised either in a standard or in an enriched environment. Environmental enrichment had a marked effect on pyramidal cell structure in control animals. Pyramidal cells in environmentally enriched control animals were significantly more branched and more spinous than non-enriched controls. However, environmental enrichment had little effect on pyramidal cell structure in Ts65Dn mice. As each dendritic spine receives at least one excitatory input, differences in the number of spines found in the dendritic arbors of pyramidal cells in the two groups reflect differences in the number of excitatory inputs they receive and, consequently, complexity in cortical circuitry. The present results suggest that behavioral deficits demonstrated in the Ts65Dn model could be attributed to abnormal circuit development.

On dendrites in Down syndrome and DS murine models: a spiny way to learn

Since the discovery in the 1970s that dendritic abnormalities in cortical pyramidal neurons are the most consistent pathologic correlate of mental retardation, research has focused on how dendritic alterations are related to reduced intellectual ability. Due in part to obvious ethical problems and in part to the lack of fruitful methods to study neuronal circuitry in the human cortex, there is little data about the microanatomical contribution to mental retardation. The recent identification of the genetic bases of some mental retardation associated alterations, coupled with the technology to create transgenic animal models and the introduction of powerful sophisticated tools in the field of microanatomy, has led to a growth in the studies of the alterations of pyramidal cell morphology in these disorders. Studies of individuals with Down syndrome, the most frequent genetic disorder leading to mental retardation, allow the analysis of the relationships between cognition, genotype and brain microanatomy. In Down syndrome the crucial question is to define the mechanisms by which an excess of normal gene products, in interaction with the environment, directs and constrains neural maturation, and how this abnormal development translates into cognition and behaviour. In the present article we discuss mainly Down syndrome-associated dendritic abnormalities and plasticity and the role of animal models in these studies. We believe that through the further development of such approaches, the study of the microanatomical substrates of mental retardation will contribute significantly to our understanding of the mechanisms underlying human brain disorders associated with mental retardation. (C) 2004 Elsevier Ltd. All rights reserved.