FRA10B structure reveals common elements in repeat expansion and chromosomal fragile site genesis

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

Chromosomal fragile site FRA16D and DNA instability in cancer

It has been proposed that common aphidicolin-inducible fragile sites, in general, predispose to specific chromosomal breakage associated with deletion, amplification, and/or translocation in certain forms of cancer. Although this appears to be the case for the fragile site FRA3B and may be the case for FRA7G, it is not Set clear whether this association is a general property of this class of fragile site. The major aim of the present study was to determine whether the FRA16D chromosomal fragile site locus has a role to play in predisposing DNA sequences within and adjacent to the fragile site to DNA instability (such as deletion or translocation), which could lead to or be associated with neoplasia. We report the localization of FRA16D within a contig of cloned DNA and demonstrate that this fragile site coincides with a region of homozygous deletion in a gastric adenocarcinoma cell line and is bracketed by translocation breakpoints in multiple myeloma, as reported previously (Chesi, M., et al., Blood, 91: 4457-4463, 1998), Therefore, given similar findings at the FRA3B and FRA7G fragile sites, it is likely that common aphidicolin-inducible fragile sites exhibit the general property of localized DNA instability in cancer cells.

Common chromosomal fragile site FRA16D sequence: identification of the FOR gene spanning FRA16D and homozygous deletions and translocation breakpoints in cancer cells

Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cytogenetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.

Folate-sensitive fragile site FRA10A is due to an expansion of a CGG repeat in a novel gene, FRA10AC1, encoding a nuclear protein

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

From Midden to Sieve: The Impact of Differential Recovery and Quantification Techniques on Interpretations of Shellfish Remains in Australian Coastal Archaeology

Experimental mechanical sieving methods are applied to samples of shellfish remains from three sites in southeast Queensland, Seven Mile Creek Mound, Sandstone Point and One-Tree, to test the efficacy of various recovery and quantification procedures commonly applied to shellfish assemblages in Australia. There has been considerable debate regarding the most appropriate sieve sizes and quantification methods that should be applied in the recovery of vertebrate faunal remains. Few studies, however, have addressed the impact of recovery and quantification methods on the interpretation of invertebrates, specifically shellfish remains. In this study, five shellfish taxa representing four bivalves (Anadara trapezia, Trichomya hirsutus, Saccostrea glomerata, Donax deltoides) and one gastropod (Pyrazus ebeninus) common in eastern Australian midden assemblages are sieved through 10mm, 6.3mm and 3.15mm mesh. Results are quantified using MNI, NISP and weight. Analyses indicate that different structural properties and pre- and postdepositional factors affect recovery rates. Fragile taxa (T. hirsutus) or those with foliated structure (S. glomerata) tend to be overrepresented by NISP measures in smaller sieve fractions, while more robust taxa (A. trapezia and P. ebeninus) tend to be overrepresented by weight measures. Results demonstrate that for all quantification methods tested a 3mm sieve should be used on all sites to allow for regional comparability and to effectively collect all available information about the shellfish remains.

X-linked myoclonic epilepsy with spasticity and intellectual disability - Mutation in the homeobox gene ARX

Objective: To describe a new syndrome of X-linked myoclonic epilepsy with generalized spasticity and intellectual disability (XMESID) and identify the gene defect underlying this disorder. Methods: The authors studied a family in which six boys over two generations had intractable seizures using a validated seizure questionnaire, clinical examination, and EEG studies. Previous records and investigations were obtained. Information on seizure disorders was obtained on 271 members of the extended family. Molecular genetic analysis included linkage studies and mutational analysis using a positional candidate gene approach. Results: All six affected boys had myoclonic seizures and TCS; two had infantile spasms, but only one had hypsarrhythmia. EEG studies show diffuse background slowing with slow generalized spike wave activity. All affected boys had moderate to profound intellectual disability. Hyperreflexia was observed in obligate carrier women. A late-onset progressive spastic ataxia in the matriarch raises the possibility of late clinical manifestations in obligate carriers. The disorder was mapped to Xp11.2-22.2 with a maximum lod score of 1.8. As recently reported, a missense mutation (1058C>T/P353L) was identified within the homeodomain of the novel human Aristaless related homeobox gene (ARX). Conclusions: XMESID is a rare X-linked recessive myoclonic epilepsy with spasticity and intellectual disability in boys. Hyperreflexia is found in carrier women. XMESID is associated with a missense mutation in ARX. This disorder is allelic with X-linked infantile spasms (ISSX; MIM 308350) where polyalanine tract expansions are the commonly observed molecular defect. Mutations of ARX are associated with a wide range of phenotypes; functional studies in the future may lend insights to the neurobiology of myoclonic seizures and infantile spasms.

Genetic heterogeneity in familial acute myelogenous leukemia: Evidence for a second locus at chromosome 16q21-23.2

The identification of genes responsible for the rare cases of familial leukemia may afford insight into the mechanism underlying the more common sporadic occurrences. Here we test a single family with 11 relevant meioses transmitting autosomal dominant acute myelogenous leukemia (AML) and myelodysplasia for linkage to three potential candidate loci. In a different family with inherited AML, linkage to chromosome 21q22.1-22.2 was recently reported; we exclude linkage to 21q22.1-22.2, demonstrating that familial AML is a heterogeneous disease. After reviewing familial leukemia and observing anticipation in the form of a declining age of onset with each generation, we had proposed 9p21-22 and 16q22 as additional candidate loci. Whereas linkage to 9p21-22 can be excluded, the finding of a maximum two-point LOD score of 2.82 with the microsatellite marker D16S522 at a recombination fraction theta = 0 provides evidence supporting linkage to 16q22. Haplotype analysis reveals a 23.5-cM (17.9-Mb) commonly inherited region among all affected family members extending from D16S451 to D1GS289, In order to extract maximum linkage information with missing individuals, incomplete informativeness with individual markers in this interval, and possible deviance from strict autosomal dominant inheritance, we performed nonparametric linkage analysis (NPL) and found a maximum NPL statistic corresponding to a P-value of .00098, close to the maximum conditional probability of linkage expected for a pedigree with this structure. Mutational analysis in this region specifically excludes expansion of the AT-rich minisatellite repeat FRA16B fragile site and the CAG trinucleotide repeat in the E2F-4 transcription factor. The ''repeat expansion detection'' method, capable of detecting dynamic mutation associated with anticipation, more generally excludes large CAG repeat expansion as a cause of leukemia in this family.

The genetic and environmental relationship between the interpersonal sensitivity measure (IPSM) and the personality dimensions of Eysenck and Cloninger

A shortened version of the Interpersonal Sensitivity Measure (IPSM) developed to predict depression prone personalities was administered in a self-report questionnaire to a community-based sample of 3269 Australian twin pairs aged 18-28 years, along with Eysenck's EPQ and Cloninger's TPQ. The IPSM included four sub-scales: Separation Anxiety (SEP); Interpersonal Sensitivity (INT); Fragile Inner-Self (FIS); and Timidity (TIM). Univariate analysis revealed that individual differences in the IPSM sub-scale scores were best explained by additive genetic and specific environmental effects. Confirming previous research findings, familial aggregation for the EPQ and TPQ personality dimensions was entirely due to additive genetic effects. In the multivariate case, a model comprising additive genetic and specific environmental effects best explained the covariation between the latent factors for male and female twin pairs alike. The EPQ and TPQ dimensions accounted for moderate to large proportions of the genetic variance (40-76%) in the IPSM sub-scales, while most of the non-shared environment variance was unique to the IPSM sub-scales. (C) 2001 Elsevier Science Ltd. All rights reserved.

Development of ligase-assisted spacer addition for the measurement of microsatellites

Conventional methods for detecting differences in microsatellite repeat lengths rely on electrophoretic fractionation on long denaturing polyacrylamide gels, a time-consuming and labor-intensive method. Therefore, there is a need for the development of new and rapid approaches to routinely detect such length polymorphisms. The advent of techniques allowing the coupling of DNA molecules to solid surfaces has provided new prospects in the area of mutation. We describe here the development and optimization of the ligase-assisted spacer addition (LASA) method, a novel and rapid procedure based on an ELISA format to measure microsatellite repeat lengths. The LASA assay was successfully applied to a set of 11 bird samples to assess its capability as a genotyping method.

Healthy ageing - Adults with intellectual disabilities: Physical health issues

This report has been prepared by the Ageing Special Interest Research Group of the International Association for the Scientific Study of Intellectual Disabilities (IASSID) in collaboration with the Department of Mental Health and Substance Dependence and the Programme on Ageing and Health, World Health Organization (WHO), Geneva, Switzerland, and all rights are reserved by the above mentioned organization. The document may, however, be freely reviewed, abstracted, reproduced or translated in part, but not for sale or use in conjunction with commercial purposes. It may also be reproduced in full by non-commercial entities for information or for educational purposes with prior permission from WHO/IASSID. The document is likely to be available in other languages also.