43 resultados para Chromosomes, Human, Pair 17

em University of Queensland eSpace - Australia


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The immunoregulatory signaling (IRS) family includes several molecules, which play major roles in the regulation of the immune response. The CMRF-35A and CMRF-35H molecules are two new members of the IRS family of molecules, that are found on a wide variety of haemopoietic lineages. The extracellular functional interactions of these molecules is presently unknown, although CMRF-35H on initiate an inhibitory signal and is internalized when cross-linked. In this paper, we described the gene structure for the CMRF-35A gene and its localization to human chromosome 17. The gene consists of four exons spanning approximately 4.5 kb. Exon 1 encodes the 5' untranslated region and leader sequence, exon 2 encodes the immunoglobulin (Ig)-like domain, exon 3 encodes the membrane proximal region and exon 4 encodes the transmembrane region, the cytoplasmic tail and the 3' untranslated region. A region in the 5' flanking sequence of the CMRF-35A gene, that promoted expression of a reporter gene was identified. The genes for the CMRF-35A and CMRF-35H molecules are closely linked on chromosome 17. Similarity between the Ig-like exons and the preceding intron of the two genes suggests exon duplication was involved in their evolution. We also identified a further member of the CMRF-35 family, the CMRF-35J pseudogene. This gene appears to have arisen by gene duplication of the CMRF-35A gene. These three loci-the CMRF-35A, CMRF-35J and CMRF-35H genes-form a new complex of IRS genes on chromosome 17.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The hypothesis of the existence of one or more schizophrenia susceptibility loci on chromosome 22q is supported by reports of genetic linkage and association, meta-analyses of linkage, and the observation of elevated risk for psychosis in people with velocardiofacial syndrome, caused by 22q11 microdeletions. We tested this hypothesis by evaluating 10 microsatellite markers spanning 22q in a multicenter sample of 779 pedigrees. We also incorporated age at onset and sex into the analysis as covariates. No significant evidence for linkage to schizophrenia or for linkage associated with earlier age at onset, gender, or heterogeneity across sites was observed. We interpret these findings to mean that the population-wide effects of putative 22q schizophrenia susceptibility loci are too weak to detect with linkage analysis even in large samples.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The tendency to dizygotic (DZ) twinning is inherited in both humans and sheep, and a fecundity gene in sheep (FecB) maps to sheep chromosome 6, syntenic with human 4q21-25. Our aim was to see whether a gene predisposing to human DZ twinning mapped to this region. DNA was collected from 169 pairs and 17 sets of 3 sisters (trios) from Australia and New Zealand who had each had spontaneous DZ twins, mostly before the age of 35, and from a replication sample of 111 families (92 affected sister pairs) from The Netherlands. Exclusion mapping was carried out after typing 26 markers on chromosome 4, of which 8 spanned the region Likely to contain the human homologue of the sheep FecB gene. We used nonparametric affected sib pair methods for linkage analysis [ASPEX 2.2, Hinds and Risch, 1999]. Complete exclusion of linkage (lod < -2) of a gene conferring a relative risk for sibs as low as 1.5 ((s) > 1.5) was obtained for all but the p terminus region on chromosome 4. Exclusion in the syntenic region was stronger, down to lambda (s) = 1.3. We concluded that if there is a gene influencing DZ twinning on chromosome 4, its effect must be minor. (C) 2001 Wiley-Liss, Inc.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

1. Eight human cytochrome P4501B1 (CYP1B1) allelic variants, namely Arg(48)Ala(119)Leu(432), Arg(48)Ala(119)Val(432), Gly(48)Ala(119)Leu(432), Gly(48)Ala(119)Val(432), Arg(48)Ser(119)Leu(432), Arg(48)Ser(119)Val(432), Gly(48)Ser(119)Leu(432) and Gly(48)Ser(119)Val(432) (all with Asn(453)), were expressed in Escherichia coli together with human NADPH-P450 reductase and their catalytic specificities towards oxidation of 17 beta -oestradiol and benzo[a]pyrene were determined. 2. All of the CYP1B1 variants expressed in bacterial membranes showed Fe2+. CO versus Fe2+ difference spectra with wavelength maxima at 446 nm and they reacted with antibodies raised against recombinant human CYP1B1 in immunoblots. The ratio of expression of the reductase to CYP1B1 in these eight preparations ranged from 0.2 to 0.5. 3. CYP1B1 Arg(48) variants tended to have higher activities for 17 beta -oestradiol 4-hydroxylation than Gly(48) variants, although there were no significant variations in 17 beta -oestradiol 2-hydroxylation activity in these eight CYP1B1 variants. Interestingly, ratios of formation of 17 beta -oestradiol 4-hydroxylation to 2-hydroxylation by these CYP1B1 variants were higher in all of the Val(432) forms than the corresponding Leu(432) forms. 4. In contrast, Leu(432) forms of CYP1B1 showed higher rates of oxidation of benzo[a]pyrene (to the 7, 8-dihydoxy-7,8-dihydrodiol in the presence of epoxide hydrolase) than did the Val(432) forms. 5. These results suggest that polymorphic human CYP1B1 variants may cause some altered catalytic specificity with 17 beta -oestradiol and benzo[a]pyrene and may influence susceptibilities of individuals towards endogenous and exogenous carcinogens.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Endometriosis is a common gynecological disease that affects up to 10% of women in their reproductive years. It causes pelvic pain, severe dysmenorrhea, and subfertility. The disease is defined as the presence of tissue resembling endometrium in sites outside the uterus. Its cause remains uncertain despite 150 years of hypothesis-driven research, and thus the therapeutic options are limited. Disease predisposition is inherited as a complex genetic trait, which provides an alternative route to understanding the disease. We seek to identify susceptibility loci, using a positional-cloning approach that starts with linkage analysis to identify genomic regions likely to harbor these genes. We conducted a linkage study of 1,176 families ( 931 from an Australian group and 245 from a U. K. group), each with at least two members-mainly affected sister pairs-with surgically diagnosed disease. We have identified a region of significant linkage on chromosome 10q26 ( maximum LOD score [MLS] of 3.09; genomewide P = .047) and another region of suggestive linkage on chromosome 20p13 MLS p 2.09). Minor peaks with MLS > 1.0) were found on chromosomes 2, 6, 7, 8, 12, 14, 15, and 17. This is the first report of linkage to a major locus for endometriosis. The findings will facilitate discovery of novel positional genetic variants that influence the risk of developing this debilitating disease. Greater understanding of the aberrant cellular and molecular mechanisms involved in the etiology and pathophysiology of endometriosis should lead to better diagnostic methods and targeted treatments.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Human N-acetyltransferase type 1 (NAT1) catalyses the N- or O-acetylation of various arylamine and heterocyclic amine substrates and is able to bioactivate several known carcinogens. Despite wide inter-individual variability in activity, historically, NAT1 was considered to be monomorphic in nature. However, recent reports of allelic variation at the NAT1 locus suggest that it may be a polymorphically expressed enzyme. In the present study, peripheral blood mononuclear cell NAT1 activity in 85 individuals was found to be bimodally distributed with approximately 8% of the population being slow acetylators. Subsequent sequencing of the individuals having slow acetylator status showed all to have either a (CT)-T-190 or G(560)A base substitution located in the protein encoding region of the NAT1 gene. The (CT)-T-190 base substitution changed a highly conserved Arg(64), which others have shown to be essential for fully functional NAT1 protein. The (CT)-T-190 mutation has not been reported previously and we have named it NAT1*17. The G(560)A mutation is associated with the base substitutions previously observed in the NAT1*10 allele and this variant (NAT1*14) encodes for a protein with reduced acetylation capacity. A novel method using linear PCR and dideoxy terminators was developed for the detection of NAT1*14 and NAT1*17. Neither of these variants was found in the rapid acetylator population. We conclude that both the (CT)-T-190 (NAT1*17) and G(560)A (NAT1*14) NAT1 structural variants are involved in a distinct NAT1 polymorphism. Because NAT1 can bioactivate several carcinogens, this polymorphism may have implications for cancer risk in individual subjects. (C) 1998 Chapman & Hall Ltd.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

1. The co-ordination between respiratory and postural functions of the diaphragm was investigated during repetitive upper Limb movement. It was hypothesised that diaphragm activity would occur either tonically or phasically in association with the forces from each movement and that this activity would combine with phasic respiratory activity. 2. Movements of the upper limb and ribcage were measured while standing subjects performed repetitive upper limb movements 'as fast as possible'. Electromyographic (EMG) recordings of the costal diaphragm were made using intramuscular electrodes in four subjects. Surface electrodes were placed over the deltoid and erector spinae muscles. 3. In contrast to standing at rest, diaphragm activity was present throughout expiration at 78 +/- 17% (mean +/- S.D.) of its peak inspiratory magnitude during repeated upper limb movement. 4. Bursts of deltoid and erector spinae EMG activity occurred at the Limb movement frequency (similar to 2.9 Hz). Although the majority of diaphragm EMG power was at the respiratory frequency (similar to 0.4 Hz), a peak was also present at the movement frequency. This finding was corroborated by averaged EMG activity triggered from upper limb movement. In addition, diaphragm EMG activity was coherent with ribcage motion at the respiratory frequency and with upper limb movement at the movement frequency. 5. The diaphragm response was similar when movement was performed while sitting. In addition, when subjects moved with increasing frequency the peak upper limb acceleration correlated with diaphragm EMG amplitude. These findings support the argument that diaphragm contraction is related to trunk control. 6. The results indicate that activity of human phrenic motoneurones is organised such that it contributes to both posture and respiration during a task which repetitively challenges trunk posture.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We have previously isolated and characterized murine MYB binding protein (p160) 1a, a protein that specifically interacts with the leucine zipper motif within the negative regulatory domain of the c-Myb proto-oncoprotein, We now describe the molecular cloning of the human MYBBP1A cDNA and chromosomal localization to 17p13.3 by fluorescence in situ hybridization analysis, Given the likely presence of a tumor suppressor gene (or genes) within this region of chromosome 17, the position of MYBBP1A was further mapped by radiation hybrid analysis and was found to lie between markers D17S1828 and D17S938. A P1 artificial chromosome clone containing the 5' region of MYBBP1A was isolated and indicates a physical linkage between MYBBP1A and the 15-lipoxygenase gene (ALOX15), A novel, polymorphic (CA)(25) dinucleotide repeat was also isolated from this PAC and may serve as a useful marker for MYBBP1A and this region of chromosome 17. (C) 1999 Academic Press.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We have generated transgenic mice that harbor a 140 kb genomic fragment of the human BRCA1 locus (TgN.BRCA1(GEN)). We find that the transgene directs appropriate expression of human BRCA1 transcripts in multiple mouse tissues, and that human BRCA1 protein is expressed and stabilized following exposure to DIVA damage, Such mice are completely normal, with no overt signs of BRCA1 toxicity commonly observed when BRCA1 is expressed from heterologous promoters. Most importantly, however, the transgene rescues the otherwise lethal phenotype associated with the targeted hypomorphic allele (Brca1(Delta exIISA)). Brca1(-/-); TgN.BRCA1(GEN) bigenic animals develop normally and can be maintained as a distinct line. These results show that a 140 kb fragment of chromosome 17 contains all elements necessary for the correct expression, localization, and function of the BRCA1 protein, Further, the model provides evidence that function and regulation of the human BRCA1 gene can be studied and manipulated in a genetically tractable mammalian system.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Reviews the book "The Human Organization of Time: Temporal Realities and Experience," by Allen C. Bluedorn.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background: A major goal in the post-genomic era is to identify and characterise disease susceptibility genes and to apply this knowledge to disease prevention and treatment. Rodents and humans have remarkably similar genomes and share closely related biochemical, physiological and pathological pathways. In this work we utilised the latest information on the mouse transcriptome as revealed by the RIKEN FANTOM2 project to identify novel human disease-related candidate genes. We define a new term patholog to mean a homolog of a human disease-related gene encoding a product ( transcript, anti-sense or protein) potentially relevant to disease. Rather than just focus on Mendelian inheritance, we applied the analysis to all potential pathologs regardless of their inheritance pattern. Results: Bioinformatic analysis and human curation of 60,770 RIKEN full-length mouse cDNA clones produced 2,578 sequences that showed similarity ( 70 - 85% identity) to known human-disease genes. Using a newly developed biological information extraction and annotation tool ( FACTS) in parallel with human expert analysis of 17,051 MEDLINE scientific abstracts we identified 182 novel potential pathologs. Of these, 36 were identified by computational tools only, 49 by human expert analysis only and 97 by both methods. These pathologs were related to neoplastic ( 53%), hereditary ( 24%), immunological ( 5%), cardio-vascular (4%), or other (14%), disorders. Conclusions: Large scale genome projects continue to produce a vast amount of data with potential application to the study of human disease. For this potential to be realised we need intelligent strategies for data categorisation and the ability to link sequence data with relevant literature. This paper demonstrates the power of combining human expert annotation with FACTS, a newly developed bioinformatics tool, to identify novel pathologs from within large-scale mouse transcript datasets.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Human sulfotransferase SULT1A1 is an important phase II xenobiotic metabolizing enzyme that is highly expressed in the liver and mediates the sulfonation of drugs, carcinogens, and steroids. Until this study, the transcriptional regulation of the SULT1A subfamily had been largely unexplored. Preliminary experiments in primary human hepatocytes showed that SULT1A mRNA levels were not changed in response to nuclear receptor activators, such as dexamethasone and 3-methylcolanthrene, unlike other metabolizing enzymes. Using HepG2 cells, the high activity of the TATA-less SULT1A1 promoter was shown to be dependent on the presence of Sp1 and Ets transcription factor binding sites (EBS), located within - 112 nucleotides from the transcriptional start site. The homologous promoter of the closely related SULT1A3 catecholamine sulfotransferase, which is expressed at negligible levels in the adult liver, displayed 70% less activity than SULT1A1. This was shown to be caused by a two-base pair difference in the EBS. The Ets transcription factor GA binding protein (GABP) was shown to bind the SULT1A1 EBS and could transactivate the SULT1A1 promoter in Drosophila melanogaster S2 cells. Cotransfection of Sp1 could synergistically enhance GABP-mediated activation by 10-fold. Although Sp1 and GABP alone could induce SULT1A3 promoter activity, the lack of the EBS on this promoter prevented a synergistic interaction between the two factors. This study reports the first insight into the transcriptional regulation of the SULT1A1 gene and identifies a crucial difference in regulation of the closely related SULT1A3 gene, which accounts for the two enzymes' differential expression patterns observed in the adult liver.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

30.00% 30.00%

Publicador:

Resumo:

An immunoperoxidase technique was used to examine CD28, CD152, CD80 and CD86 positive cells in gingival biopsies from 21 healthy/gingivitis and 26 periodontitis subjects. The samples were placed into 3 groups (small, intermediate, large) according to the size of the infiltrate. The percent CD28+ T cells in the connective tissue infiltrates was highly variable with no differences between the healthy/gingivitis and periodontitis groups. While there was an increase in positive cells in intermediate infiltrates from both healthy/gingivitis (28.5%) and periodontitis (21.4%) patients compared with small infiltrates (8.6% and 11.8%, respectively), this was not significant, although the percent CD28+ T cells did increase significantly in tissues with increased proportions of B cells relative to T cells (p=0.047). A mean of less than 5% infiltrating T cells were CD152+ which was significantly lower than the mean percent CD28+ T cells in intermediate healthy/gingivitis lesions (p=0.021). The mean percent CD80+ and CD86+ B cells and macrophages was 1–7% and 8–16%, respectively, the difference being significant in intermediate healthy/gingivitis tissues (p=0.012). Analysis of these cells in relation to increasing numbers of B cells in proportion to T cells and also to macrophages, suggested that CD80 was expressed predominantly by macrophages while CD86 was expressed by both macrophages and B cells. Few endothelial cells expressed CD80 or CD86. Keratinocytes displayed cytoplasmic staining of CD80 rather than CD86 although the numbers of positive specimens in the healthy/gingivitis and periodontitis groups reduced with increasing inflammation. In conclusion, percentages of CD28, CD152, CD80 and CD86 did not reflect differences in clinical status. However, the percent CD28+ T cells increased with increasing size of infiltrate and with increasing proportions of B cells suggesting increased T/B cell interactions with increasing inflammation. The percent CD152+ cells remained low indicating that CD152 may not be involved in negative regulation of T cells in periodontal disease. CD80 and CD86 have been reported to promote Th1 and Th2 responses, respectively, and the higher percent CD86+ cells suggests a predominance of Th2 responses in both healthy/gingivitis and periodontitis tissues. Nevertheless, other factors including cytokines themselves and chemokines which modulate T cell cytokine profiles must be monitored to determine the nature of Th1/Th2 responses in periodontal disease.