Hepatocellular carcinoma

Detailed analyses of chromosomal damage in hepatocellular carcinoma have confirmed the results of previous studies that identified regions of significant loss. In addition, these studies examined the clinicopathological correlates of this damage, identified new sites for future investigation, and provided evidence of interactions between genes, The insulin-like growth factor II receptor gene is a target for inactivation through chromosomal loss and mutation, with loss also occurring in the cirrhotic liver. The insulin-like growth factor II receptor gene plays a central role in coordinating the competing actions of insulin-like growth factor and transforming growth factor-beta on cell proliferation. Our understanding of the changes in these growth factor pathways helps explain the apparent increase in risk of hepatocellular carcinoma in diabetic patients and the potential use of urinary transforming growth factor-beta in screening tests. Vaccination for hepatitis B in Taiwan has had a significant effect on the incidence of childhood hepatocellular carcinoma. Universal vaccination should result in a major reduction in the incidence of hepatocellular carcinoma worldwide.

Genotoxicity of inorganic mercury salts based on disturbed microtubule function

This study investigated the hypothesis that the chromosomal genotoxicity of inorganic mercury results from interaction(s) with cytoskeletal proteins. Effects of Hg2+ salts on functional activities of tubulin and kinesin were investigated by determining tubulin assembly and kinesin-driven motility in cell-free systems. Hg2+ inhibits microtubule assembly at concentrations above 1 muM, and inhibition is complete at about 10 muM. In this range, the tubulin assembly is fully ( up to 6 muM) or partially (similar to 6 - 10 muM) reversible. The inhibition of tubulin assembly by mercury is independent of the anion, chloride or nitrate. The no-observed-effect-concentration for inhibition of microtubule assembly in vitro was 1 muM Hg2+, the IC50 5.8 muM. Mercury(II) salts at the IC50 concentrations partly inhibiting tubulin assembly did not cause the formation of aberrant microtubule structures. Effects of mercury salts on the functionality of the microtubule motility apparatus were studied with the motor protein kinesin. By using a gliding assay'' mimicking intracellular movement and transport processes in vitro, HgCl2 affected the gliding velocity of paclitaxel-stabilised microtubules in a clear dose-dependent manner. An apparent effect is detected at a concentration of 0.1 muM and a complete inhibition is reached at 1 muM. Cytotoxicity of mercury chloride was studied in V79 cells using neutral red uptake, showing an influence above 17 muM HgCl2. Between 15 and 20 muM HgCl2 there was a steep increase in cell toxicity. Both mercury chloride and mercury nitrate induced micronuclei concentration-dependently, starting at concentrations above 0.01 muM. CREST analyses on micronuclei formation in V79 cells demonstrated both clastogenic (CREST-negative) and aneugenic effects of Hg2+, with some preponderance of aneugenicity. A morphological effect of high Hg2+ concentrations ( 100 muM HgCl2) on the microtubule cytoskeleton was verified in V79 cells by immuno-fluorescence staining. The overall data are consistent with the concept that the chromosomal genotoxicity could be due to interaction of Hg2+ with the motor protein kinesin mediating cellular transport processes. Interactions of Hg2+ with the tubulin shown by in vitro investigations could also partly influence intracellular microtubule functions leading, together with the effects on the kinesin, to an impaired chromosome distribution as shown by the micronucleus test.

The origin of a Robertsonian chromosomal translocation in house mice inferred from linked microsatellite markers

The Western European house mouse, Mus domesticus, includes many distinct Robertsonian (Rb) chromosomal races. Two competing hypotheses may explain the distribution of Rb translocations found in different populations: they may have arisen independently multiple times or they may have arisen once and been spread through long distance dispersal. We investigated the origin of the Rb 5.15 translocation using 6 microsatellite loci linked to the centromeres of chromosomes 5 and 15 in 84 individuals from 3 Rb populations and 4 neighboring standard-karyotype populations. Microsatellite variation on the 5.15 metacentric chromosomes was significantly reduced relative to the amount of variation found on acrocentric chromosomes 5 and 15, suggesting that linked microsatellite loci can track specific mutational events. Phylogenetic analyses resulted in trees which are consistent with multiple origins of the 5.15 metacentric found in the three Rb populations. These results suggest that cytologically indistinguishable mutations have arisen independently in natural populations of house mice.

FRA10B structure reveals common elements in repeat expansion and chromosomal fragile site genesis

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

A second Candida albicans resistance gene (Carg2) regulates tissue damage, but not fungal clearance, in sub-lethal murine systemic infection

The severity of systemic infection with the yeast Candida albicans has been shown to be under complex genetic control. C57/L mice carry an allele that is associated with an increase in tissue destruction when compared with C57BI/6 mice; however, the gene affects only the severity of tissue lesions, and does not influence the magnitude of the fungal burden in either kidney or brain. Studies in [C57/L x C57BI/6]F1 hybrid mice, and [C57/L x C57BI/6]F1 x C57/L backcross mice, demonstrated that the gene behaves as a simple Mendelian co-dominant. (C) 1998 Academic Press.

Molecular cloning and chromosomal mapping of the human homologue of MYB binding protein (P160) 1A (MYBBP1A) to 17p13.3

We have previously isolated and characterized murine MYB binding protein (p160) 1a, a protein that specifically interacts with the leucine zipper motif within the negative regulatory domain of the c-Myb proto-oncoprotein, We now describe the molecular cloning of the human MYBBP1A cDNA and chromosomal localization to 17p13.3 by fluorescence in situ hybridization analysis, Given the likely presence of a tumor suppressor gene (or genes) within this region of chromosome 17, the position of MYBBP1A was further mapped by radiation hybrid analysis and was found to lie between markers D17S1828 and D17S938. A P1 artificial chromosome clone containing the 5' region of MYBBP1A was isolated and indicates a physical linkage between MYBBP1A and the 15-lipoxygenase gene (ALOX15), A novel, polymorphic (CA)(25) dinucleotide repeat was also isolated from this PAC and may serve as a useful marker for MYBBP1A and this region of chromosome 17. (C) 1999 Academic Press.

Chromosomal fragile site FRA16D and DNA instability in cancer

It has been proposed that common aphidicolin-inducible fragile sites, in general, predispose to specific chromosomal breakage associated with deletion, amplification, and/or translocation in certain forms of cancer. Although this appears to be the case for the fragile site FRA3B and may be the case for FRA7G, it is not Set clear whether this association is a general property of this class of fragile site. The major aim of the present study was to determine whether the FRA16D chromosomal fragile site locus has a role to play in predisposing DNA sequences within and adjacent to the fragile site to DNA instability (such as deletion or translocation), which could lead to or be associated with neoplasia. We report the localization of FRA16D within a contig of cloned DNA and demonstrate that this fragile site coincides with a region of homozygous deletion in a gastric adenocarcinoma cell line and is bracketed by translocation breakpoints in multiple myeloma, as reported previously (Chesi, M., et al., Blood, 91: 4457-4463, 1998), Therefore, given similar findings at the FRA3B and FRA7G fragile sites, it is likely that common aphidicolin-inducible fragile sites exhibit the general property of localized DNA instability in cancer cells.

Common chromosomal fragile site FRA16D sequence: identification of the FOR gene spanning FRA16D and homozygous deletions and translocation breakpoints in cancer cells

Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cytogenetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.

Extensive chromosomal variation associated with taxon divergence and host specificity in the gall-inducing scale insect Apiomorpha munita (Schrader) (Hemiptera : Sternorrhyncha : Coccoidea : Eriococcidae)

Apiomorpha Rubsaamen (Hemiptera: Coccoidea: Eriococcidae) is one of the most chromosomally diverse of all animal genera. There is extensive karyotypic variation within many of the morphologically defined species, including A. munita (Schrader) which is here reported to have diploid chromosome counts ranging from 6 to more than 100. Each of the three morphologically defined subspecies of A. munita also displays considerable chromosomal variation: A. m. tereticornuta Gullan (2n =6, 8, 20, 22 or 24), A. m. malleensis Gullan (2n =6, 20, 22, 24 or 26), and A. m. munita (Schrader) (2n=54 or >100). Apiomorpha munita appears to occur only on eucalypts of the informal subgenus Symphyomyrtus, with each of the subspecies of A. munita restricted to discrete symphyomyrt sections. Several different karyotypic forms within each subspecies of A. munita appear to be restricted to only one or a few eucalypt species or series. The association between apparent host specificity and chromosomal rearrangements in A. munita suggests that both may be playing an active role in taxon divergence in Apiomorpha. (C) 2001 The Linnean Society of London.

Attentional modulation of visual cortex activity following right parietal damage in humans

Pathological inattention following parietal damage causes perceptual impairments for visual stimuli in the contralesional hemifield. Here we used functional magnetic resonance imaging (fMRI) to examine visual cortex activity in parietal patients as they performed a spatial attention task. Righthemisphere patients and healthy controls viewed counterphasing checkerboards in which coloured targets appeared briefly within the contralesional and ipsilesional hemifields. In separate fMRI runs participants focused their attention covertiy on the left or right hemifield, or on both hemifields concurrentiy. They were required to detect coloured targets that appeared briefly within the attended hemifield(s), and to withhold responses to distractor stimuli. Neural activit}' was significantly attenuated in early visual areas within the damaged hemisphere. Crucially, although attention significantiy modulated early visual activit}' within the intact (left) hemisphere, there was relatively littie modulation of activity within the affected hemisphere. Our findings suggest that parietal lesions alter early cortical responses to contralesional visual inputs.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Evidence that two independent host genes influence the severity of tissue damage and susceptibility to acute pyelonephritis in murine systemic candidiasis

Tissue damage in the kidney and brain after systemic infection with Candida albicans was examined in recombinant inbred strains (AKXL) derived from AKR and C57/L progenitors. Nine of the 15 strains showed mild (C57/L-like) tissue damage. Of the remainder, two strains developed lesions comparable to the AKR parental strain, whereas four exhibited a much move severe pattern of tissue damage. This was characterized by pronounced mycelial growth in the brain, and gross oedema of the kidney, with extensive fungal colonization and marked tissue destruction. The presence of the null allele of the haemolytic complement gene (Hc) may be necessary but not sufficient, for the expression of the very severe lesions. The results were interpreted as reflecting the actions of two independent genes, which have been designated Carg1 and Carg2 (Candida albicans resistance genes 1 and 2). (C) 1997 Academic Press Limited.

White stem borer damage and grain yield in irrigated rice in West Java, Indonesia

Factors influencing the relationship between whiteheads caused by the white stem borer Scirpophaga innotata (Walker) and grain yield were investigated. We determined the effect of different numbers of whiteheads on grain yield using different cultivars, nitrogen application, and at different field locations in Cilamaya, West Java. At the same number of panicles and whiteheads per plant, yield reduction is greater in cisadane than in IR64. With increasing nitrogen application, the range in panicle height increased. Except for Ketan, more whiteheads were recorded in shorter panicles. Two locations planted to the same cultivar showed different relationships between whiteheads and grain yield. The relationship between whiteheads and grain yield depends on the distribution of whiteheads in the field. Unless these factors have been taken into consideration, it may be difficult to make a damage prediction of white stem borer in the field. (C) 1997 Published by Elsevier Science Ltd.