68 resultados para CHROMOSOMAL-ABNORMALITIES

em University of Queensland eSpace - Australia


Relevância:

60.00% 60.00%

Publicador:

Resumo:

Objective To determine the mode of inheritance of congenital proportionate dwarfism in Angus and Angus crossbred cattle, initially detected in two commercial beef herds in northern New South Wales. Design Matings of normal carrier sires to unrelated cows of diverse breeds, and of one carrier sire to his unaffected daughters. An unrelated Piedmontese bull was also mated to unaffected daughters of the carrier sires. Procedure Two carrier Angus bulls and nine unaffected daughters, all of whom were completely indistinguishable from normal animals, were purchased for controlled breeding studies under known nutritional and disease conditions. Affected and carrier individuals were examined for the presence of obvious chromosomal abnormalities. Results Angus dwarfism has been successfully reproduced under controlled experimental conditions over successive years using unrelated dams and is undoubtedly heritable. The high frequency of occurrence of affected individuals (23/61 = 0.38 +/- .06) among the progeny of matings of the Angus sires to unrelated females of diverse breeding is not compatible with recessive inheritance, because of the negligible frequency of proportionate dwarfism in the breeds of the dams. Both paternal and maternal transmission of the defect was demonstrated, so that imprinting in the strict sense of a gene that is only expressed when received from the male parent appears not to be involved. Tested individuals showed no evidence of gross chromosomal abnormality. Dominant autosomal inheritance with incomplete penetrance was indicated by the lack of expression of the defective gene in the two Angus sires and in three unaffected daughters who produced dwarf calves from matings to the Piedmontese bull. Conclusions The mode of inheritance is that of a single autosomal dominant gene with a penetrance coefficient of 0.75 +/- 0.12, estimated from the observed incidence of 23/61 affected offspring of the two carrier Angus bulls mated to unrelated dams. Simple genetic models involving either (i) an unstable mutant which changes at high frequency to the expressed dominant dwarfing allele during gametogenesis, or (ii) a dominant allele with penetrance determined by an unlinked modifying locus, are shown to be compatible with the experimental data. Both models indicate that penetrance of the dwarfing gene may possibly be higher in matings involving carrier daughters of the two Angus bulls.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Western European house mouse, Mus domesticus, includes many distinct Robertsonian (Rb) chromosomal races. Two competing hypotheses may explain the distribution of Rb translocations found in different populations: they may have arisen independently multiple times or they may have arisen once and been spread through long distance dispersal. We investigated the origin of the Rb 5.15 translocation using 6 microsatellite loci linked to the centromeres of chromosomes 5 and 15 in 84 individuals from 3 Rb populations and 4 neighboring standard-karyotype populations. Microsatellite variation on the 5.15 metacentric chromosomes was significantly reduced relative to the amount of variation found on acrocentric chromosomes 5 and 15, suggesting that linked microsatellite loci can track specific mutational events. Phylogenetic analyses resulted in trees which are consistent with multiple origins of the 5.15 metacentric found in the three Rb populations. These results suggest that cytologically indistinguishable mutations have arisen independently in natural populations of house mice.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We have previously isolated and characterized murine MYB binding protein (p160) 1a, a protein that specifically interacts with the leucine zipper motif within the negative regulatory domain of the c-Myb proto-oncoprotein, We now describe the molecular cloning of the human MYBBP1A cDNA and chromosomal localization to 17p13.3 by fluorescence in situ hybridization analysis, Given the likely presence of a tumor suppressor gene (or genes) within this region of chromosome 17, the position of MYBBP1A was further mapped by radiation hybrid analysis and was found to lie between markers D17S1828 and D17S938. A P1 artificial chromosome clone containing the 5' region of MYBBP1A was isolated and indicates a physical linkage between MYBBP1A and the 15-lipoxygenase gene (ALOX15), A novel, polymorphic (CA)(25) dinucleotide repeat was also isolated from this PAC and may serve as a useful marker for MYBBP1A and this region of chromosome 17. (C) 1999 Academic Press.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

It has been proposed that common aphidicolin-inducible fragile sites, in general, predispose to specific chromosomal breakage associated with deletion, amplification, and/or translocation in certain forms of cancer. Although this appears to be the case for the fragile site FRA3B and may be the case for FRA7G, it is not Set clear whether this association is a general property of this class of fragile site. The major aim of the present study was to determine whether the FRA16D chromosomal fragile site locus has a role to play in predisposing DNA sequences within and adjacent to the fragile site to DNA instability (such as deletion or translocation), which could lead to or be associated with neoplasia. We report the localization of FRA16D within a contig of cloned DNA and demonstrate that this fragile site coincides with a region of homozygous deletion in a gastric adenocarcinoma cell line and is bracketed by translocation breakpoints in multiple myeloma, as reported previously (Chesi, M., et al., Blood, 91: 4457-4463, 1998), Therefore, given similar findings at the FRA3B and FRA7G fragile sites, it is likely that common aphidicolin-inducible fragile sites exhibit the general property of localized DNA instability in cancer cells.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cytogenetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Apiomorpha Rubsaamen (Hemiptera: Coccoidea: Eriococcidae) is one of the most chromosomally diverse of all animal genera. There is extensive karyotypic variation within many of the morphologically defined species, including A. munita (Schrader) which is here reported to have diploid chromosome counts ranging from 6 to more than 100. Each of the three morphologically defined subspecies of A. munita also displays considerable chromosomal variation: A. m. tereticornuta Gullan (2n =6, 8, 20, 22 or 24), A. m. malleensis Gullan (2n =6, 20, 22, 24 or 26), and A. m. munita (Schrader) (2n=54 or >100). Apiomorpha munita appears to occur only on eucalypts of the informal subgenus Symphyomyrtus, with each of the subspecies of A. munita restricted to discrete symphyomyrt sections. Several different karyotypic forms within each subspecies of A. munita appear to be restricted to only one or a few eucalypt species or series. The association between apparent host specificity and chromosomal rearrangements in A. munita suggests that both may be playing an active role in taxon divergence in Apiomorpha. (C) 2001 The Linnean Society of London.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We recently generated a sodium sulphate cotransporter knock-out mouse (Nas1-/-) which has increased urinary sulphate excretion and hyposulphataemia. To examine the consequences of disturbed sulphate homeostasis in the modulation of mouse behavioural characteristics, Nas1-/- mice were compared with Nas1+/- and Nas1+/+ littermates in a series of behavioural tests. The Nas1-/- mice displayed significantly (P < 0.001) decreased marble burying behaviour (4.33 +/- 0.82 buried) when compared to Nas1+/+ (7.86 +/- 0.44) and Nas1+/- (8.40 +/- 0.37) animals, suggesting that Nas1-/- mice may have decreased object-induced anxiety. The Nas1-/- mice also displayed decreased locomotor activity by moving less distance (1.53 +/- 0.27 m, P < 0.05) in an open-field test when compared to Nas1+/+ (2.31 +/- 0.24 m) and Nas1+/- (2.15 +/- 0.19 m) mice. The three genotypes displayed similar spatiotemporal and ethological behaviours in the elevated-plus maze and open-field test, with the exception of a decreased defecation frequency by the Nas1-/- mice (40% reduction, P < 0.01). There were no significant differences between Nas1-/- and Nas1+/+ mice in a rotarod performance test of motor coordination and in the forced swim test assessing (anti-)depressant-like behaviours. This is the first study to demonstrate behavioural abnormalities in the hyposulphataemic Nas1-/- mice. (C) 2004 Elsevier B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective: As part of a randomised double-blind study of a new atypical antipsychotic we sought to determine both the levels of visual acuity and the occurrence of toxic side-effects in a group of patients treated for many years on a variety of antipsychotics. Method: Twenty-three inpatients with a DSM-III-R diagnosis of chronic schizophrenia from two separate hospital locations who met the criteria for the double-blind trial were examined for ocular abnormalities at both baseline and at trial completion. Results: At baseline a high prevalence of abnormalities was identified: 19 patients (82.6%) were found to have one or more ocular abnormalities, including lens opacities/cataracts and corneal pigmentation; three patients, with delusions related to the sun, were noted to have solar burns; a high proportion (almost 70%) of patients had untreated visual acuity problems. No further changes were observed at the follow-up examinations. Conclusions: The possible causes of ocular disturbance in schizophrenia and the reasons for the relatively high ocular morbidity in this group are thought to result from both illness-related factors and the effects of antipsychotic medication. Causality is confounded by a number of issues such as the high prevalence of smoking, poor general health and the variety of antipsychotic medications used in the treatment of psychosis as well as substance abuse. The clinical implications are considered in this paper in relation to the move towards community-based psychiatric services.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Abnormal left ventricular (LV) filling is common, but not universal, in hypertensive LV hypertrophy (LVH). We sought to elucidate the relative contributions of myocardial structural changes, loading and hypertrophy to LV dysfunction in 113 patients: 85 with hypertensive LVH and 28 controls without LVH and with normal filling. Patients with normal dobutamine stress echocardiography and no history of coronary artery disease were selected, in order to exclude a contribution from ischaemia or scar. Abnormal LV filling was identified in 65 LVH patients, based on Doppler measurement of transmitral filling and annular velocities. All patients underwent grey-scale and colour tissue Doppler imaging from three apical views, which were stored and analysed off line. Integrated backscatter (113) and strain rate imaging were used to detect changes in structure and function; average cyclic variation of 113, strain rate and peak systolic strain were calculated by averaging each segment. Calibrated 113 intensity, corrected for pericardial 113 intensity, was measured in the septum and posterior wall from the parasternal long-axis view. Patients with LVH differed significantly from controls with respect to all backscatter and strain parameters, irrespective of the presence or absence of abnormal LV filling. LVH patients with and without abnormal LV filling differed with regard to age, LV mass and incidence of diabetes mellitus, but also showed significant differences in cyclic variation (P < 0.01), calibrated 113 in the posterior wall (P < 0.05) and strain rate (P < 0.01), although blood pressure, heart rate and LV systolic function were similar. Multivariate logistic regression analysis demonstrated that age, LV mass index and calibrated IB in the posterior wall were independent determinants of abnormal LV filling in patients with LVH. Thus structural and functional abnormalities can be detected in hypertensive patients with LVH with and without abnormal LV filling. In addition to age and LVH, structural (not functional) abnormalities are likely to contribute to abnormal LV filling, and may be an early sign of LV damage. 113 is useful for the detection of myocardial abnormalities in patients with hypertensive LVH.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Increasingly, cystic fibrosis (CF) is regarded as an inflammatory disorder where the response of the lung to Pseudomonas aeruginosa is exaggerated as a consequence of processes mediated by the product of the CF gene, CFTR. Of importance to any gene-replacement strategy for treatment of CF is the identification of the cell type(s) within the lung milieu that need to be corrected and an indication whether this is sufficient to restore a normal inflammatory response and bacterial clearance. We generated G551D CF mice transgenically expressing the human CFTR gene in two tissue compartments previously demonstrated to mediate a CFTR-dependent inflammatory response: lung epithelium and alveolar macrophages. Following chronic pulmonary infection with P. aeruginosa, CF mice with epithelial-expressed but not macrophage-specific CFTR showed an improvement in pathogen clearance and inflammatory markers compared with control CF animals. Additionally, these data indicate the general role for epithelial cell-mediated events in the response of the lung to bacterial pathogens and the importance of CFTR in mediating these processes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To define the location of potential oncogenes and tumor suppressor genes in ocular melanoma we carried out comparative genomic hybridization (CGH) analysis on a population-based series of 25 formalin-fixed, paraffin-embedded primary tumors comprising 17 choroidal, 2 ciliary body, 4 iris, and 2 conjunctival melanomas. Twelve (48%) of the 25 melanomas showed no chromosomal changes and 13 (52%) had at least one chromosomal gain or loss. The mean number of CGH changes in all tumors was 3.3, with similar mean numbers of chromosomal gains (1.5) and losses (1.8). The highest number of chromosomal changes (i.e., nine) occurred in a conjunctival melanoma and included four changes not observed in tumors at any other ocular site (gains in 22q and 11p and losses in 6p and 17p). The most frequent gains in all primary ocular melanomas were on chromosome arm 8q (69%), 6p (31%) and 8p (23%) and the most frequent losses were on 6q (38%), 10q (23%), and 16q (23%). The most common pairing was gain in 8p and gain in 8q, implying a whole chromosome copy number increase; gains in 8p occurred only in conjunction with gains in 8q. The smallest regions of copy number alteration were mapped to gain of 8q21 and loss of 6q21, 10q21, and 16q22. Sublocalization of these chromosomal changes to single-band resolution should accelerate the identification of genes involved in the genesis of ocular melanoma.