Chromosomal gains and losses in ocular melanoma detected by comparative genomic hybridization in an Australian population-based study

To define the location of potential oncogenes and tumor suppressor genes in ocular melanoma we carried out comparative genomic hybridization (CGH) analysis on a population-based series of 25 formalin-fixed, paraffin-embedded primary tumors comprising 17 choroidal, 2 ciliary body, 4 iris, and 2 conjunctival melanomas. Twelve (48%) of the 25 melanomas showed no chromosomal changes and 13 (52%) had at least one chromosomal gain or loss. The mean number of CGH changes in all tumors was 3.3, with similar mean numbers of chromosomal gains (1.5) and losses (1.8). The highest number of chromosomal changes (i.e., nine) occurred in a conjunctival melanoma and included four changes not observed in tumors at any other ocular site (gains in 22q and 11p and losses in 6p and 17p). The most frequent gains in all primary ocular melanomas were on chromosome arm 8q (69%), 6p (31%) and 8p (23%) and the most frequent losses were on 6q (38%), 10q (23%), and 16q (23%). The most common pairing was gain in 8p and gain in 8q, implying a whole chromosome copy number increase; gains in 8p occurred only in conjunction with gains in 8q. The smallest regions of copy number alteration were mapped to gain of 8q21 and loss of 6q21, 10q21, and 16q22. Sublocalization of these chromosomal changes to single-band resolution should accelerate the identification of genes involved in the genesis of ocular melanoma.

The origin of a Robertsonian chromosomal translocation in house mice inferred from linked microsatellite markers

The Western European house mouse, Mus domesticus, includes many distinct Robertsonian (Rb) chromosomal races. Two competing hypotheses may explain the distribution of Rb translocations found in different populations: they may have arisen independently multiple times or they may have arisen once and been spread through long distance dispersal. We investigated the origin of the Rb 5.15 translocation using 6 microsatellite loci linked to the centromeres of chromosomes 5 and 15 in 84 individuals from 3 Rb populations and 4 neighboring standard-karyotype populations. Microsatellite variation on the 5.15 metacentric chromosomes was significantly reduced relative to the amount of variation found on acrocentric chromosomes 5 and 15, suggesting that linked microsatellite loci can track specific mutational events. Phylogenetic analyses resulted in trees which are consistent with multiple origins of the 5.15 metacentric found in the three Rb populations. These results suggest that cytologically indistinguishable mutations have arisen independently in natural populations of house mice.

FRA10B structure reveals common elements in repeat expansion and chromosomal fragile site genesis

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

Molecular cloning and chromosomal mapping of the human homologue of MYB binding protein (P160) 1A (MYBBP1A) to 17p13.3

We have previously isolated and characterized murine MYB binding protein (p160) 1a, a protein that specifically interacts with the leucine zipper motif within the negative regulatory domain of the c-Myb proto-oncoprotein, We now describe the molecular cloning of the human MYBBP1A cDNA and chromosomal localization to 17p13.3 by fluorescence in situ hybridization analysis, Given the likely presence of a tumor suppressor gene (or genes) within this region of chromosome 17, the position of MYBBP1A was further mapped by radiation hybrid analysis and was found to lie between markers D17S1828 and D17S938. A P1 artificial chromosome clone containing the 5' region of MYBBP1A was isolated and indicates a physical linkage between MYBBP1A and the 15-lipoxygenase gene (ALOX15), A novel, polymorphic (CA)(25) dinucleotide repeat was also isolated from this PAC and may serve as a useful marker for MYBBP1A and this region of chromosome 17. (C) 1999 Academic Press.

Chromosomal fragile site FRA16D and DNA instability in cancer

It has been proposed that common aphidicolin-inducible fragile sites, in general, predispose to specific chromosomal breakage associated with deletion, amplification, and/or translocation in certain forms of cancer. Although this appears to be the case for the fragile site FRA3B and may be the case for FRA7G, it is not Set clear whether this association is a general property of this class of fragile site. The major aim of the present study was to determine whether the FRA16D chromosomal fragile site locus has a role to play in predisposing DNA sequences within and adjacent to the fragile site to DNA instability (such as deletion or translocation), which could lead to or be associated with neoplasia. We report the localization of FRA16D within a contig of cloned DNA and demonstrate that this fragile site coincides with a region of homozygous deletion in a gastric adenocarcinoma cell line and is bracketed by translocation breakpoints in multiple myeloma, as reported previously (Chesi, M., et al., Blood, 91: 4457-4463, 1998), Therefore, given similar findings at the FRA3B and FRA7G fragile sites, it is likely that common aphidicolin-inducible fragile sites exhibit the general property of localized DNA instability in cancer cells.

Common chromosomal fragile site FRA16D sequence: identification of the FOR gene spanning FRA16D and homozygous deletions and translocation breakpoints in cancer cells

Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cytogenetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.

Extensive chromosomal variation associated with taxon divergence and host specificity in the gall-inducing scale insect Apiomorpha munita (Schrader) (Hemiptera : Sternorrhyncha : Coccoidea : Eriococcidae)

Apiomorpha Rubsaamen (Hemiptera: Coccoidea: Eriococcidae) is one of the most chromosomally diverse of all animal genera. There is extensive karyotypic variation within many of the morphologically defined species, including A. munita (Schrader) which is here reported to have diploid chromosome counts ranging from 6 to more than 100. Each of the three morphologically defined subspecies of A. munita also displays considerable chromosomal variation: A. m. tereticornuta Gullan (2n =6, 8, 20, 22 or 24), A. m. malleensis Gullan (2n =6, 20, 22, 24 or 26), and A. m. munita (Schrader) (2n=54 or >100). Apiomorpha munita appears to occur only on eucalypts of the informal subgenus Symphyomyrtus, with each of the subspecies of A. munita restricted to discrete symphyomyrt sections. Several different karyotypic forms within each subspecies of A. munita appear to be restricted to only one or a few eucalypt species or series. The association between apparent host specificity and chromosomal rearrangements in A. munita suggests that both may be playing an active role in taxon divergence in Apiomorpha. (C) 2001 The Linnean Society of London.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Recurrent gains and losses of large (84-109 bp) repeats in the rDNA internal transcribed spacer 2 (ITS2) of rhipicephaline ticks

We studied the internal transcribed spacer 2 (ITS2) in twenty-two spp. of ticks from the subfamily Rhipicephalinae. A 104-109 base pair (bp) region was Imperfectly repeated In most ticks studied. Mapping the number of repeat copies on to a phylogeny from the ITS2 showed that there have been many Independent gains and losses of repeats. Comparison of the sequences of the repeat copies Indicated that in most taxa concerted evolution had played little if any role in the evolution of these regions, as the copies clustered by sequence position rather than species, In our putative secondary structure, each repeat copy can fold into a distinct and almost identical stem-loop complex; a gain or loss of a repeat copy apparently does not impair the function of the ITS2 in these ticks.

Liveweight gains of steers at different stocking rates on monospecific Gatton panic and Estrella grass pastures in the Chaco Central region of Paraguay

A grazing trial to study the effect of stocking rate on animal production and botanical composition of Gallon panic (Panicum maximum) and Estrella grass (Cynodon nlemfuensis) was conducted in the central region of the Paraguayan Chaco between 1992 and 1998. The experiment included 6 stocking rates (0.5, 0.8. 1.1, 1.4. 1.7 and 2.0 AU/ha) on individual 4-ha paddocks. The pasture treatments were continuously grazed by yearling steers. replaced annually, over a 4-year grazing period. No fertiliser was used. Botanical composition was recorded annually in autumn from 1992 to 1998 while animal production data were recorded monthly from 1992 to 1996. Relationships between animal productivity and stocking rates were determined by regression analysis. Gallon panic produced greater liveweight gains per head than Estrella grass at low and intermediate stocking rates. However, the slope of the linear relationship between liveweight gain per head and stocking rate increased each year in Gallon panic indicating that the productivity of this grass progressively declined at higher stocking rates over the period of observation. Estrella grass showed less sensitivity to stocking rate but was affected severely by periods of low rainfall.

Estimates of global and regional potential health gains from reducing multiple major risk factors

Background Estimates of the disease burden due to multiple risk factors can show the potential gain from combined preventive measures. But few such investigations have been attempted, and none on a global scale. Our aim was to estimate the potential health benefits from removal of multiple major risk factors. Methods We assessed the burden of disease and injury attributable to the joint effects of 20 selected leading risk factors in 14 epidemiological subregions of the world. We estimated population attributable fractions, defined as the proportional reduction in disease or mortality that would occur if exposure to a risk factor were reduced to an alternative level, from data for risk factor prevalence and hazard size. For every disease, we estimated joint population attributable fractions, for multiple risk factors, by age and sex, from the direct contributions of individual risk factors. To obtain the direct hazards, we reviewed publications and re-analysed cohort data to account for that part of hazard that is mediated through other risks. Results Globally, an estimated 47% of premature deaths and 39% of total disease burden in 2000 resulted from the joint effects of the risk factors considered. These risks caused a substantial proportion of important diseases, including diarrhoea (92%-94%), lower respiratory infections (55-62%), lung cancer (72%), chronic obstructive pulmonary disease (60%), ischaemic heart disease (83-89%), and stroke (70-76%). Removal of these risks would have increased global healthy life expectancy by 9.3 years (17%) ranging from 4.4 years (6%) in the developed countries of the western Pacific to 16.1 years (43%) in parts of sub-Saharan Africa. Interpretation Removal of major risk factors would not only increase healthy life expectancy in every region, but also reduce some of the differences between regions, The potential for disease prevention and health gain from tackling major known risks simultaneously would be substantial.