Analysis of genetic diversity in Cassia brewsteri with randomly amplified DNA fingerprints (RAFS)

Genetic diversity in Cassia brewsteri (F. Muell.) F. Muell. ex Benth. was assessed with Randomly Amplified DNA Fingerprints (RAFs). Thirty accessions of C. brewsteri collected from throughout its natural distribution were analysed with three random decamer primers, along with three accessions of C. tomentella (Benth.) Domin and a single accession of each of C. queenslandica C. T. White and C. marksiana (F. M. Bailey) Domin. The three primers yielded a reproducible amplification profile of 265 scorable polymorphic fragments for the 35 accessions. These molecular markers were used to calculate Nei and Li similarity coefficients between each pair of individuals. A matrix of dissimilarity of each pair of individuals was examined by multidimensional scaling (MDS). The analysis supports the division of C. brewsteri into two subspecies and the suggestion that intergradation of C. brewsteri and C. tomentella can occur where the distributions of these species meet.

A genetic map of macadamia based on randomly amplified DNA fingerprinting (RAF) markers

The first genetic linkage map of macadamia (Macadamia integrifolia and M. tetraphylla) is presented. The map is based on 56 F-1 progeny of cultivars 'Keauhou' and 'A16'. Eighty-four percent of the 382 markers analysed segregated as Mendelian loci. The two-way pseudo-testcross mapping strategy allowed construction of separate parental cultivar maps. Ninety bridging loci enabled merging of these maps to produce a detailed genetic map of macadamia, 1100 cM in length and spanning 70-80% of the genome. The combined map comprised 24 linkage groups with 265 framework markers: 259 markers from randomly amplified DNA fingerprinting (RAF), five random amplified polymorphic DNA (RAPD), and one sequence-tagged microsatellite site (STMS). The RAF marker system unexpectedly revealed 16 codominant markers, one of them a putative microsatellite locus and exhibiting four distinct alleles in the cross. This molecular study is the most comprehensive examination to date of genetic loci of macadamia, and is a major step towards developing marker-assisted selection for this crop.

A DNA fingerprinting procedure for ultra high-throughput genetic analysis of insects

Existing procedures for the generation of polymorphic DNA markers are not optimal for insect studies in which the organisms are often tiny and background molecular Information is often non-existent. We have used a new high throughput DNA marker generation protocol called randomly amplified DNA fingerprints (RAF) to analyse the genetic variability In three separate strains of the stored grain pest, Rhyzopertha dominica. This protocol is quick, robust and reliable even though it requires minimal sample preparation, minute amounts of DNA and no prior molecular analysis of the organism. Arbitrarily selected oligonucleotide primers routinely produced similar to 50 scoreable polymorphic DNA markers, between individuals of three Independent field isolates of R. dominica. Multivariate cluster analysis using forty-nine arbitrarily selected polymorphisms generated from a single primer reliably separated individuals into three clades corresponding to their geographical origin. The resulting clades were quite distinct, with an average genetic difference of 37.5 +/- 6.0% between clades and of 21.0 +/- 7.1% between individuals within clades. As a prelude to future gene mapping efforts, we have also assessed the performance of RAF under conditions commonly used in gene mapping. In this analysis, fingerprints from pooled DNA samples accurately and reproducibly reflected RAF profiles obtained from Individual DNA samples that had been combined to create the bulked samples.

HLA class II antigens positively and negatively associated with hepatosplenic schistosomiasis in a Chinese population

To identify possible associations between host genetic factors and the onset of liver fibrosis following Schistosoma japonicum infection, the major histocompatibility class II alleles of 84 individuals living on an island (Jishan) endemic for schistosomiasis japonica in the Poyang Lake Region of Southern China were determined. Forty patients exhibiting advanced schistosomiasis, characterised by extensive liver fibrosis, and 44 age and sex-matched control subjects were assessed for the class II haplotypes HLA-DRBI and HLA-DQB1. Two HLA-DRB1 alleles, HLA-DRB1*0901 (P = 0.012) and *1302 (P = 0.039), and two HLA-DQB1 alleles, HLA-DQB1*0303 (P = 0.012) and *0609 (P = 0.037), were found to be significantly associated with susceptibility to fibrosis. These associated DRB1 and DQB1 alleles are in very strong linkage disequilibrium, with DRB1*0901-DQB1*0303 and DRB1*1302-DQB1*0609 found as: common haplotypes in this population. In contrast, the alleles HLA-DRB1*1501 (P = 0.025) and HLA-DQB 1*0601 (P = 0.022) were found to be associated with resistance to hepatosplenic disease. Moreover, the alleles DQB1*0303 and DRB1*0901 did not increase susceptibility in the presence of DQB1*0601, indicating that DQB1*0601 is dominant over DQB1*0303 and DRB1*0901. The study has thus identified both positive and negative associations between HLA class II alleles and the risk of individuals developing moderate to severe liver fibrosis following schistosome infection. (C) 2001 Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved.

Genetic linkage analysis of the lesser grain borer Rhyzopertha dominica identifies two loci that confer high-level resistance to the fumigant phosphine

High levels of inheritable resistance to phosphine in Rhyzopertha dominica have recently, been detected in Australia and hi art effort to isolate the genes responsible For resistance we have used random amplified DNA fingerprinting (RAF) to produce a genetic linkage map of R. dominica. The map consists of 94 dominant DNA markers with art average distance between markers of 4.6 cM and defines nine linkage groups with a total recombination distance of 390.1 cM. We have identified two loci that are responsible for high-level resistance. One provides similar to50x resistance to phosphine while the other provides 12.5x resistance and in combination, the two genes act synergistically to provide a resistance level 250 x greater than that of fully susceptible beetles. The haploid genome size has been determined to be 4.76 x 10(8) bp, resulting in an average physical distance of 1.2 Mbp per map unit. No recombination has been observed between either of the two resistance loci and their adjacent DNA markers in a population of 44 fully resistant F-5 individuals, which indicates that the genes are likely to reside within 0.91 cM (1.1 Mbp) of the DNA markers.

Genetic diversity revealed in the apomictic fruit species Garcinia mangostana L. (mangosteen)

The novel molecular marker technique Randomly Amplified DNA Fingerprinting (RAF) was used to survey genetic relationships between 37 accessions of the tropical fruit G. mangostana (mangosteen) and among 11 accessions from eight other Garcinia species. Although mangosteen is believed to reproduce exclusively through apomixis, our results show that considerable genetic diversity exists within G. mangostana and between other Garcinia species. Among the 37 G. mangostana accessions examined, nine different genotypes were identified which clustered into three distinct groups based on correspondence analysis (reciprocal averaging). For 26 (70%) of the accessions no marker variation was detected over 530 loci screened. A further eight (22%) accessions exhibited very low levels of variation (0.2-1%) suggesting at least one well conservedm angosteen genotype. The remaining three accessions (8%) showed extensive variation (22-31%) compared with the majority of accessions. The three mangosteen groups were 63-70% dissimilar to the other Garcinia species investigated. The genetic diversity identified in this research will assist in the conservation of Garcinia germplasm and provides a valuable framework for the genetic improvement of mangosteen.

Fine mapping of the tomato I-3 gene for fusarium wilt resistance and elimination of a co-segregating resistance gene analogue as a candidate for I-3

The I-3 gene from the wild tomato species Lycopersicon pennellii confers resistance to race 3 of the devastating vascular wilt pathogen Fusarium oxysporum f. sp. lycopersici. As an initial step in a positional cloning strategy for the isolation of I-3, we converted restriction fragment length polymorphism and conserved orthologue set markers, known genes and a resistance gene analogue (RGA) mapping to the I-3 region into PCR-based sequence characterised amplified region (SCAR) and cleaved amplified polymorphic sequence (CAPS) markers. Additional PCR-based markers in the I-3 region were generated using the randomly amplified DNA fingerprinting (RAF) technique. SCAR, CAPS and RAF markers were used for high-resolution mapping around the I-3 locus. The I-3 gene was localised to a 0.3-cM region containing a RAF marker, eO6, and an RGA, RGA332. RGA332 was cloned and found to correspond to a putative pseudogene with at least two loss-of-function mutations. The predicted pseudogene belongs to the Toll interleukin-1 receptor-nucleotide-binding site-leucine-rich-repeat sub-class of plant disease resistance genes. Despite the presence of two RGA332 homologues in L. esculentum, DNA gel blot and PCR analysis suggests that no other homologues are present in lines carrying I-3 that could be alternative candidates for the gene.

A comparison of molecular markers for genetic analysis of macadamia

Various marker systems exist for genetic analysis of horticultural species. Isozymes were first applied to the woody perennial nut crop, macadamia, in the early 1990s. The advent of DNA markers saw the development, for macadamia, of STMS (sequence-tagged microsatellite site), RAPD (randomly amplified polymorphic DNA), and RAF (randomly amplified DNA fingerprinting). The RAF technique typically generates dominant markers, but within the dominant marker profiles, certain primers also amplify multi-allelic co-dominant markers that are suspected to be microsatellites. In this paper, we confirm this for one such marker, and describe how RAF primers can be chosen that amplify one or more putative microsatellites. This approach of genotyping anonymous microsatellite markers via RAF is designated RAMiFi (randomly amplified microsatellite fingerprinting). Several marker systems were compared for the type, amount, and cost-efficiency of the information generated, using data from published studies on macadamia. The markers were also compared for the way they clustered a common set of accessions. The RAMiFi approach was identified as the most efficient and economical. The availability of such a versatile tool offers many advantages for the genetic characterisation of horticultural species.

Isolation of genotype- and chromosome-specific DNA markers in a biotype of Colletotrichum gloeosporioides using random amplified polymorphic DNA analysis

Genetic markers that distinguish fungal genotypes are important tools for genetic analysis of heterokaryosis and parasexual recombination in fungi. Random amplified polymorphic DNA (RAPD) markers that distinguish two races of biotype B of Colletotrichum gloeosporioides infecting the legume Stylosanthes guianensis were sought. Eighty-five arbitrary oligonucleotide primers were used to generate 895 RAPD bands but only two bands were found to be specifically amplified from DNA of the race 3 isolate. These two RAPD bands were used as DNA probes and hybridised only to DNA of the race 3 isolate. Both RAPD bands hybridised to a dispensable 1.2 Mb chromosome of the race 3 isolate. No other genotype-specific chromosomes or DNA sequences were identified in either the race 2 or race 3 isolates. The RAPD markers hybridised to a 2 Mb chromosome in all races of the genetically distinct biotype A pathogen which infects other species of Stylosanthes as well as S. guianensis. The experiments indicate that RAPD analysis is a potentially useful tool for obtaining genotype-and chromosome-specific DNA probes in closely related isolates of one biotype of this fungal pathogen.

An identification tool for the Australian weedy Sporobolus species based on random amplified polymorphic DNA (RAPD) profiles

Based on morphological features alone, there is considerable difficulty in identifying the 5 most economically damaging weed species of Sporobolus [ viz. S. pyramidalis P. Beauv., S. natalensis ( Steud.) Dur and Schinz, S. fertilis ( Steud.) Clayton, S. africanus (Poir.) Robyns and Tourney, and S. jacquemontii Kunth.] found in Australia. A polymerase chain reaction (PCR)-based random amplified polymorphic DNA ( RAPD) technique was used to create a series of genetic markers that could positively identify the 5 major weeds from the other less damaging weedy and native Sporobolus species. In the initial RAPD pro. ling experiment, using arbitrarily selected primers and involving 12 species of Sporobolus, 12 genetic markers were found that, when used in combination, could consistently identify the 5 weedy species from all others. Of these 12 markers, the most diagnostic were UBC51(490) for S. pyramidalis and S. natalensis; UBC43(310,2000,2100) for S. fertilis and S. africanus; and OPA20(850) and UBC43(470) for S. jacquemontii. Species-specific markers could be found only for S. jacquemontii. In an effort to understand why there was difficulty in obtaining species-specific markers for some of the weedy species, a RAPD data matrix was created using 40 RAPD products. These 40 products amplified by 6 random primers from 45 individuals belonging to 12 species, were then subjected to numerical taxonomy and multivariate system (NTSYS pc version 1.70) analysis. The RAPD similarity matrix generated from the analysis indicated that S. pyramidalis was genetically more similar to S. natalensis than to other species of the 'S. indicus complex'. Similarly, S. jacquemontii was more similar to S. pyramidalis, and S. fertilis was more similar to S. africanus than to other species of the complex. Sporobolus pyramidalis, S. jacquemontii, S. africanus, and S. creber exhibited a low within-species genetic diversity, whereas high genetic diversity was observed within S. natalensis, S. fertilis, S. sessilis, S. elongates, and S. laxus. Cluster analysis placed all of the introduced species ( major and minor weedy species) into one major cluster, with S. pyramidalis and S. natalensis in one distinct subcluster and S. fertilis and S. africanus in another. The native species formed separate clusters in the phenograms. The close genetic similarity of S. pyramidalis to S. natalensis, and S. fertilis to S. africanus may explain the difficulty in obtaining RAPD species-specific markers. The importance of these results will be within the Australian dairy and beef industries and will aid in the development of integrated management strategy for these weeds.

Gene and genotypic diversity of Phytophthora cinnamomi in South Africa and Australia revealed by DNA polymorphisms

Phytophthora cinnamomi isolates from South Africa and Australia were compared to assess genetic differentiation between the two populations. These two populations were analysed for levels of phenotypic diversity using random amplified polymorphic DNAs (RAPDs) and gene and genotypic diversity using restriction fragment length polymorphisms (RFLPs). Sixteen RAPD markers from four decanucleotide Operon primers and 34 RFLP alleles from 15 putative loci were used. A few isolates from Papua New Guinea known to posses alleles different from Australian isolates were also included for comparative purposes. South African and Australian P. cinnamomi populations were almost identical with an extremely low level of genetic distance between them (D-m = 0.003). Common features for the two populations include shared alleles, low levels of phenotypic/genotypic diversity, high clonality, and low observed and expected levels of heterozygosity. Furthermore, relatively high levels of genetic differentiation between mating type populations (D-m South Africa = 0.020 and D-m Australia = 0.025 respectively), negative fixation indices, and significant deviations from Hardy-Weinberg equilibrium, all provided evidence for the lack of frequent sexual reproduction in both populations. The data strongly suggest that both the South African and Australian P. cinnamomi populations are introduced.

EDD, the human orthologue of the hyperplastic discs tumour suppressor gene, is amplified and overexpressed in cancer

EDD (E3 isolated by differential display), located at chromosome 8q22.3, is the human orthologue of the Drosophila melanogaster tumour suppressor gene 'hyperplastic discs' and encodes a HECT domain E3 ubiquitin protein-ligase. To investigate the possible involvement of EDD in human cancer, several cancers from diverse tissue sites were analysed for allelic gain or loss (allelic imbalance, AI) at the EDD locus using an EDD-specific microsatellite, CEDD, and other polymorphic microsatellites mapped in the vicinity of the 8q22.3 locus. Of 143 cancers studied, 38 had AI at CEDD (42% of 90 informative cases). In 14 of these cases, discrete regions of imbalance encompassing 8q22.3 were present, while the remainder had more extensive 8q aberrations. AI of CEDD was most frequent in ovarian cancer (22/47 informative cases, 47%), particularly in the serous subtype (16/22, 73%), but was rare in benign and borderline ovarian tumours. AI was also common in breast cancer (31%), hepatocellular carcinoma (46%), squamous cell carcinoma of the tongue (50%) and metastatic melanoma (18%). AI is likely to represent amplification of the EDD gene locus rather than loss of heterozygosity, as quantitative RT-PCR and immunohistochemistry showed that EDD mRNA and protein are frequently overexpressed in breast and ovarian cancers, while among breast cancer cell lines EDD overexpression and increased gene copy number were correlated. These results demonstrate that AI at the EDD locus is common in a diversity of carcinomas and that the EDD gene is frequently overexpressed in breast and ovarian cancer, implying a potential role in cancer progression.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).