34 resultados para AMPLIFIED SAMPLE STACKING

em University of Queensland eSpace - Australia


Relevância:

20.00% 20.00%

Publicador:

Resumo:

A study was conducted to examine the relationships among eating pathology, weight dissatisfaction and dieting, and unwanted sexual experiences in childhood. An unselected community sample of 201 young and 268 middle-aged women were administered questionnaires assessing eating behaviors and attitudes, and past and current sexual abuse. Results showed differential relationships among these factors for the two age cohorts: for young women, past sexual abuse predicted weight dissatisfaction, but not dieting or disordered eating behaviors, whereas for middle-aged women, past abuse was predictive of disordered eating, but not dieting or weight dissatisfaction. Current physical or sexual abuse was also found to be predictive of disordered eating for the young women. These findings underscore the complexity of the relationships among unwanted sexual experiences and eating and weight pathology, and suggest that the timing of sexual abuse, and the age of the woman, are important mediating factors. (C) 1998 Elsevier Science Inc.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Genetic markers that distinguish fungal genotypes are important tools for genetic analysis of heterokaryosis and parasexual recombination in fungi. Random amplified polymorphic DNA (RAPD) markers that distinguish two races of biotype B of Colletotrichum gloeosporioides infecting the legume Stylosanthes guianensis were sought. Eighty-five arbitrary oligonucleotide primers were used to generate 895 RAPD bands but only two bands were found to be specifically amplified from DNA of the race 3 isolate. These two RAPD bands were used as DNA probes and hybridised only to DNA of the race 3 isolate. Both RAPD bands hybridised to a dispensable 1.2 Mb chromosome of the race 3 isolate. No other genotype-specific chromosomes or DNA sequences were identified in either the race 2 or race 3 isolates. The RAPD markers hybridised to a 2 Mb chromosome in all races of the genetically distinct biotype A pathogen which infects other species of Stylosanthes as well as S. guianensis. The experiments indicate that RAPD analysis is a potentially useful tool for obtaining genotype-and chromosome-specific DNA probes in closely related isolates of one biotype of this fungal pathogen.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objectives. To investigate the test-retest stability of a standardized version of Nelson's (1976) Modified Card Sorting Test (MCST) and its relationships with demographic variables in a sample of healthy older adults. Design. A standard card order and administration were devised for the MCST and administered to participants at an initial assessment, and again at a second session conducted a minimum of six months later in order to examine its test-retest stability. Participants were also administered the WAIS-R at initial assessment in order to provide a measure of psychometric intelligence. Methods. Thirty-six (24 female, 12 male) healthy older adults aged 52 to 77 years with mean education 12.42 years (SD = 3.53) completed the MCST on two occasions approximately 7.5 months (SD = 1.61) apart. Stability coefficients and test-retest differences were calculated for the range of scores. The effect of gender on MCST performance was examined. Correlations between MCST scores and age, education and WAIS-R IQs were also determined. Results. Stability coefficients ranged from .26 for the percent perseverative errors measure to .49 for the failure to maintain set measure. Several measures were significantly correlated with age, education and WAIS-R IQs, although no effect of gender on MCST performance was found. Conclusions. None of the stability coefficients reached the level required for clinical decision making. The results indicate that participants' age, education, and intelligence need to be considered when interpreting MCST performance. Normative studies of MCST performance as well as further studies with patients with executive dysfunction are needed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We investigate the X-ray properties of the Parkes sample of Bat-spectrum radio sources using data from the ROSAT All-Sky Survey and archival pointed PSPC observations. In total, 163 of the 323 sources are detected. For the remaining 160 sources, 2 sigma upper limits to the X-ray flux are derived. We present power-law photon indices in the 0.1-2.4 keV energy band for 115 sources, which were determined either with a hardness ratio technique or from direct fits to pointed PSPC data if a sufficient number of photons were available. The average photon index is <Gamma > = 1.95(-0.12)(+0.13) for flat-spectrum radio-loud quasars, <Gamma > = 1.70(-0.24)(+0.23) for galaxies, and <Gamma > = 2.40(-0.31)(+0.12) for BL Lac objects. The soft X-ray photon index is correlated with redshift and with radio spectral index in the sense that sources at high redshift and/or with flat (or inverted) radio spectra have flatter X-ray spectra on average. The results are in accord with orientation-dependent unification schemes for radio-loud active galactic nuclei. Webster et al. discovered many sources with unusually red optical continua among the quasars of this sample, and interpreted this result in terms of extinction by dust. Although the X-ray spectra in general do not show excess absorption, we find that low-redshift optically red quasars have significantly lower soft X-ray luminosities on average than objects with blue optical continua. The difference disappears for higher redshifts, as is expected for intrinsic absorption by cold gas associated with the dust. In addition, the scatter in log(f(x)/f(o)) is consistent with the observed optical extinction, contrary to previous claims based on optically or X-ray selected samples. Although alternative explanations for the red optical continua cannot be excluded with the present X-ray data, we note that the observed X-ray properties are consistent with the idea that dust plays an important role in some of the radio-loud quasars with red optical continua.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Multiple sampling is widely used in vadose zone percolation experiments to investigate the extent in which soil structure heterogeneities influence the spatial and temporal distributions of water and solutes. In this note, a simple, robust, mathematical model, based on the beta-statistical distribution, is proposed as a method of quantifying the magnitude of heterogeneity in such experiments. The model relies on fitting two parameters, alpha and zeta to the cumulative elution curves generated in multiple-sample percolation experiments. The model does not require knowledge of the soil structure. A homogeneous or uniform distribution of a solute and/or soil-water is indicated by alpha = zeta = 1, Using these parameters, a heterogeneity index (HI) is defined as root 3 times the ratio of the standard deviation and mean. Uniform or homogeneous flow of water or solutes is indicated by HI = 1 and heterogeneity is indicated by HI > 1. A large value for this index may indicate preferential flow. The heterogeneity index relies only on knowledge of the elution curves generated from multiple sample percolation experiments and is, therefore, easily calculated. The index may also be used to describe and compare the differences in solute and soil-water percolation from different experiments. The use of this index is discussed for several different leaching experiments. (C) 1999 Elsevier Science B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Fornax Spectroscopic Survey will use the Two degree Field spectrograph (2dF) of the Angle-Australian Telescope to obtain spectra for a complete sample of all 14000 objects with 16.5 less than or equal to b(j) less than or equal to 19.7 in a 12 square degree area centred on the Fornax Cluster. The aims of this project include the study of dwarf galaxies in the cluster (both known low surface brightness objects and putative normal surface brightness dwarfs) and a comparison sample of background field galaxies. We will also measure quasars and other active galaxies, any previously unrecognised compact galaxies and a large sample of Galactic stars. By selecting all objects-both stars and galaxies-independent of morphology, we cover a much larger range of surface brightness and scale size than previous surveys. In this paper we first describe the design of the survey. Our targets are selected from UK Schmidt Telescope sky survey plates digitised by the Automated Plate Measuring (APM) facility. We then describe the photometric and astrometric calibration of these data and show that the APM astrometry is accurate enough for use with the 2dF. We also describe a general approach to object identification using cross-correlations which allows us to identify and classify both stellar and galaxy spectra. We present results from the first 2dF field. Redshift distributions and velocity structures are shown for all observed objects in the direction of Fornax, including Galactic stars? galaxies in and around the Fornax Cluster, and for the background galaxy population. The velocity data for the stars show the contributions from the different Galactic components, plus a small tail to high velocities. We find no galaxies in the foreground to the cluster in our 2dF field. The Fornax Cluster is clearly defined kinematically. The mean velocity from the 26 cluster members having reliable redshifts is 1560 +/- 80 km s(-1). They show a velocity dispersion of 380 +/- 50 km s(-1). Large-scale structure can be traced behind the cluster to a redshift beyond z = 0.3. Background compact galaxies and low surface brightness galaxies are found to follow the general galaxy distribution.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Rates of cell size increase are an important measure of success during the baculovirus infection process. Batch and fed batch cultures sustain large fluctuations in osmolarity that can affect the measured cell volume if this parameter is not considered during the sizing protocol. Where osmolarity differences between the sizing diluent and the culture broth exist, biased measurements of size are obtained as a result of the cell osmometer response. Spodoptera frugiperda (Sf9) cells are highly sensitive to volume change when subjected to a change in osmolarity. Use of the modified protocol with culture supernatants for sample dilution prior to sizing removed the observed error during measurement.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Fornax Cluster Spectroscopic Survey (FCSS) project utilizes the Two-degree Field (2dF) multi-object spectrograph on the Anglo-Australian Telescope (AAT). Its aim is to obtain spectra for a complete sample of all 14 000 objects with 16 5 less than or equal to b(j) less than or equal to 19 7 irrespective of their morphology in a 12 deg(2) area centred on the Fornax cluster. A sample of 24 Fornax cluster members has been identified from the first 2dF field (3.1 deg(2) in area) to be completed. This is the first complete sample of cluster objects of known distance with well-defined selection limits. Nineteen of the galaxies (with -15.8 < M-B < 12.7) appear to be conventional dwarf elliptical (dE) or dwarf S0 (dS0) galaxies. The other five objects (with -13.6 < M-B < 11.3) are those galaxies which were described recently by Drinkwater et al. and labelled 'ultracompact dwarfs' (UCDs). A major result is that the conventional dwarfs all have scale sizes alpha greater than or similar to 3 arcsec (similar or equal to300 pc). This apparent minimum scale size implies an equivalent minimum luminosity for a dwarf of a given surface brightness. This produces a limit on their distribution in the magnitude-surface brightness plane, such that we do not observe dEs with high surface brightnesses but faint absolute magnitudes. Above this observed minimum scale size of 3 arcsec, the dEs and dS0s fill the whole area of the magnitude-surface brightness plane sampled by our selection limits. The observed correlation between magnitude and surface brightness noted by several recent studies of brighter galaxies is not seen with our fainter cluster sample. A comparison of our results with the Fornax Cluster Catalog (FCC) of Ferguson illustrates that attempts to determine cluster membership solely on the basis of observed morphology can produce significant errors. The FCC identified 17 of the 24 FCSS sample (i.e. 71 per cent) as being 'cluster' members, in particular missing all five of the UCDs. The FCC also suffers from significant contamination: within the FCSS's field and selection limits, 23 per cent of those objects described as cluster members by the FCC are shown by the FCSS to be background objects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

EDD (E3 isolated by differential display), located at chromosome 8q22.3, is the human orthologue of the Drosophila melanogaster tumour suppressor gene 'hyperplastic discs' and encodes a HECT domain E3 ubiquitin protein-ligase. To investigate the possible involvement of EDD in human cancer, several cancers from diverse tissue sites were analysed for allelic gain or loss (allelic imbalance, AI) at the EDD locus using an EDD-specific microsatellite, CEDD, and other polymorphic microsatellites mapped in the vicinity of the 8q22.3 locus. Of 143 cancers studied, 38 had AI at CEDD (42% of 90 informative cases). In 14 of these cases, discrete regions of imbalance encompassing 8q22.3 were present, while the remainder had more extensive 8q aberrations. AI of CEDD was most frequent in ovarian cancer (22/47 informative cases, 47%), particularly in the serous subtype (16/22, 73%), but was rare in benign and borderline ovarian tumours. AI was also common in breast cancer (31%), hepatocellular carcinoma (46%), squamous cell carcinoma of the tongue (50%) and metastatic melanoma (18%). AI is likely to represent amplification of the EDD gene locus rather than loss of heterozygosity, as quantitative RT-PCR and immunohistochemistry showed that EDD mRNA and protein are frequently overexpressed in breast and ovarian cancers, while among breast cancer cell lines EDD overexpression and increased gene copy number were correlated. These results demonstrate that AI at the EDD locus is common in a diversity of carcinomas and that the EDD gene is frequently overexpressed in breast and ovarian cancer, implying a potential role in cancer progression.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The suspension Chinese Hamster Ovary cell line, 13-10-302, utilizing the metallothionein (MT) expression system producing recombinant human growth hormone (hGH) was studied in a serum-free and cadmium-free medium at different fermentation scales and modes of operation. Initial experiments were carried out to optimize the concentration of metal addition to induce the MT promoter. Subsequently, the cultivation of the 13-10-302 cell line was scaled up from spinner flasks into bioreactors, and the cultivation duration was extended with fed-batch and perfusion strategies utilizing 180 muM zinc to induce the promoter controlling expression of recombinant hGH. It was shown that a fed-batch process could increase the maximum cell numbers twofold, from 3.3 to 6.3 x 10(6) cell/mL, over those obtained in normal batch fermentations, and this coupled with extended fermentation times resulted in a fourfold increase in final hGH titer, from 135 +/- 15 to 670 +/- 70 mg/L at a specific productivity q(hGH) value of 12 pg cell(-1)d(-1). The addition of sodium butyrate increased the specific productivity of hGH in cells to a value of approximately 48 pg cell(-1)d(-1), resulting in a final hGH titer of over a gram per liter during fed-batch runs. A BioSep acoustic cell recycler was used to retain the cells in the bioreactor during perfusion operation. It was necessary to maintain the specific feeding rates (SFR) above a value of 0.2 vvd/(10(6) cell/mL) to maintain the viability and productivity of the 13-10-302 cells; under these conditions the viable cell number increased to over 107 cell/mL and resulted in a volumetric productivity of over 120 mg(hGH) L(-1)d(-1). Process development described in this work demonstrates cultivation at various scales and sustained high levels of productivity under cadmium free condition in a CHO cell line utilizing an inducible metallothionein expression system. (C) 2004 Wiley Periodicals, Inc.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We present a new sample of Parkes half-jansky flat-spectrum radio sources, having made a particular effort to find any previously unidentified sources. The sample contains 323 sources selected according to a flux limit of 0.5 Jy at 2.7 GHz, a spectral index measured between 2.7 and 5.0 GHz of alpha(2.7/5.0) > -0.5, where S(nu) proportional to nu(alpha), Galactic latitude \b\ > 20 degrees and -45 degrees < declination (B1950) < +10 degrees. The sample was selected from a region 3.90 steradians in area. We have obtained accurate radio positions for all the unresolved sources in this sample, and combined these with accurate optical positions from digitized photographic sky survey data to check all the optical identifications. We report new identifications based on R- and Kn-band imaging and new spectroscopic measurements of many of the sources. We present a catalogue of the 323 sources, of which 321 now have identified optical counterparts and 277 have measured spectral redshifts.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).