301 resultados para glyicne-rich protein


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Human sulfotransferase SULT1A1 is an important phase II xenobiotic metabolizing enzyme that is highly expressed in the liver and mediates the sulfonation of drugs, carcinogens, and steroids. Until this study, the transcriptional regulation of the SULT1A subfamily had been largely unexplored. Preliminary experiments in primary human hepatocytes showed that SULT1A mRNA levels were not changed in response to nuclear receptor activators, such as dexamethasone and 3-methylcolanthrene, unlike other metabolizing enzymes. Using HepG2 cells, the high activity of the TATA-less SULT1A1 promoter was shown to be dependent on the presence of Sp1 and Ets transcription factor binding sites (EBS), located within - 112 nucleotides from the transcriptional start site. The homologous promoter of the closely related SULT1A3 catecholamine sulfotransferase, which is expressed at negligible levels in the adult liver, displayed 70% less activity than SULT1A1. This was shown to be caused by a two-base pair difference in the EBS. The Ets transcription factor GA binding protein (GABP) was shown to bind the SULT1A1 EBS and could transactivate the SULT1A1 promoter in Drosophila melanogaster S2 cells. Cotransfection of Sp1 could synergistically enhance GABP-mediated activation by 10-fold. Although Sp1 and GABP alone could induce SULT1A3 promoter activity, the lack of the EBS on this promoter prevented a synergistic interaction between the two factors. This study reports the first insight into the transcriptional regulation of the SULT1A1 gene and identifies a crucial difference in regulation of the closely related SULT1A3 gene, which accounts for the two enzymes' differential expression patterns observed in the adult liver.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A mutant version of the N-terminal domain of Escherichia coli DnaB helicase was used as a model system to assess the stabilization against unfolding gained by covalent cyclization. Cyclization was achieved in vivo by formation of an amide bond between the N and C termini with the help of a split mini-intein. Linear and circular proteins were constructed to be identical in amino acid sequence. Mutagenesis of Phe102 to Glu rendered the protein monomeric even at high concentration. A difference in free energy of unfolding, DeltaDeltaG, between circular and linear protein of 2.3(+/-0.5) kcal mol(-1) was measured at 10degreesC by circular dichroism. A theoretical estimate of the difference in conformational entropy of linear and circular random chains in a three-dimensional cubic lattice model predicted DeltaDeltaG = 2.3 kcal mol(-1), suggesting that stabilization by protein cyclization is driven by the reduced conformational entropy of the unfolded state. Amide-proton exchange rates measured by NMR spectroscopy and mass spectrometry showed a uniform, approximately tenfold decrease of the exchange rates of the most slowly exchanging amide protons, demonstrating that cyclization globally decreases the unfolding rate of the protein. The amide proton exchange was found to follow EX1 kinetics at near-neutral pH, in agreement with an unusually slow refolding I measured by stopped-flow circular dichroism. rate of less than 4 min(-1) The linear and circular proteins differed more in their unfolding than in their folding rates. Global unfolding of the N-terminal domain of E. coli DnaB is thus promoted strongly by spatial separation of the N and C termini, whereas their proximity is much less important for folding. (C) 2005 Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Geospatial clustering must be designed in such a way that it takes into account the special features of geoinformation and the peculiar nature of geographical environments in order to successfully derive geospatially interesting global concentrations and localized excesses. This paper examines families of geospaital clustering recently proposed in the data mining community and identifies several features and issues especially important to geospatial clustering in data-rich environments.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The myosin-associated giant protein kinases twitchin and titin are composed predominantly of fibronectin- and immunoglobulin-like modules, We report the crystal structures of two autoinhibited twitchin kinase fragments, one from Aplysia and a larger fragment from Caenorhabditis elegans containing an additional C-terminal immunoglobulin-like domain, The structure of the longer fragment shoes that the immunoglobulin domain contacts the protein kinase domain on the opposite side from the catalytic cleft, laterally exposing potential myosin binding residues, Together, the structures reveal the cooperative interactions between the autoregulatory region and the residues from the catalytic domain involved in protein substrate binding, ATP binding, catalysis and the activation loop, and explain the differences between the observed autoinhibitory mechanism and the one found in the structure of calmodulin-dependent kinase I.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The field of protein crystallography inspires and enthrals, whether it be for the beauty and symmetry of a perfectly formed protein crystal, the unlocked secrets of a novel protein fold, or the precise atomic-level detail yielded from a protein-ligand complex. Since 1958, when the first protein structure was solved, there have been tremendous advances in all aspects of protein crystallography, from protein preparation and crystallisation through to diffraction data measurement and structure refinement. These advances have significantly reduced the time required to solve protein crystal structures, while at the same time substantially improving the quality and resolution of the resulting structures. Moreover, the technological developments have induced researchers to tackle ever more complex systems, including ribosomes and intact membrane-bound proteins, with a reasonable expectation of success. In this review, the steps involved in determining a protein crystal structure are described and the impact of recent methodological advances identified. Protein crystal structures have proved to be extraordinarily useful in medicinal chemistry research, particularly with respect to inhibitor design. The precise interaction between a drug and its receptor can be visualised at the molecular level using protein crystal structures, and this information then used to improve the complementarity and thus increase the potency and selectivity of an inhibitor. The use of protein crystal structures in receptor-based drug design is highlighted by (i) HIV protease, (ii) influenza virus neuraminidase and (iii) prostaglandin H-2-synthetase. These represent, respectively, examples of protein crystal structures that (i) influenced the design of drugs currently approved for use in the treatment of HIV infection, (ii) led to the design of compounds currently in clinical trials for the treatment of influenza infection and (iii) could enable the design of highly specific non-steroidal anti-inflammatory drugs that lack the common side-effects of this drug class.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Chinese Hamster Ovary (CHO) cells are widely used for the large scale production of recombinant biopharmaceuticals. Growth of the CHO-K1 cell line has been demonstrated in serum-free medium containing insulin, transferrin and selenium. In an attempt to get autocrine growth in protein-free medium, DNA coding for insulin and transferrin production was transfected into CHO-K1 cells. Transferrin was expressed well, with clones secreting approximately 1000 ng/10(6)cells/24h. Insulin was poorly expressed, with rates peaking at 5 ng/10(6)cells/24h. Characterisation of the secreted insulin indicated that the CHO cells were incompletely processing the insulin molecule. Site-directed mutagenesis was used to introduce a furin (prohormone converting enzyme) recognition sequence into the insulin molecule, allowing the production of active insulin. However, the levels were still too low to support autocrine growth. Further investigations revealed insulin degrading activity (presumably due to the presence of insulin degrading enzymes) in the cytoplasm of CHO cells. To overcome these problems insulin-like growth factor I (instead of insulin) was transfected into the cells. IGF-1 was completely processed and expressed at rates greater than 500 ng/10(6)cells/24h. In this paper we report autonomous growth of the transfected CHO-K1 cell line expressing transferrin and IGF-1 in protein-free medium without the addition of exogenous growth factors. Growth rates and final cell densities of these cells were identical to that of the parent cell line CHO-K1 growing in insulin, transferrin, and selenium supplemented serum-free media.

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This report describes the identification of a murine cytomegalovirus (MCMV) G protein-coupled receptor (GCR) homolog. This open reading frame (M33) is most closely related to, and collinear with, human cytomegalovirus UL33, and homologs are also present in human herpesvirus 6 and 7 (U12 for both viruses). Conserved counterparts in the sequenced alpha- or gammaherpesviruses have not been identified to date, suggesting that these genes encode proteins which are important for the biological characteristics of betaherpesviruses. We have detected transcripts for both UL33 and M33 as early as 3 or 4 h postinfection, and these reappear at late times. In addition, we have identified N-terminal splicing for both the UL33 and M33 RNA transcripts. For both open reading frames, splicing results in the introduction of amino acids which are highly conserved among known GCRs. To characterise the function of the M33 in the natural host, two independent MCMV recombinant viruses were prepared, each of which possesses an M33 open reading frame which has been disrupted with the beta-galactosidase gene. While the recombinant M33 null viruses showed no phenotypic differences in replication from wild-type MCMV in primary mouse embryo fibroblasts in vitro, they showed severely restricted growth in the salivary glands of infected mice. These data suggest that M33 plays an important role in vivo, in particular in the dissemination to or replication in the salivary gland, and provide the first evidence for the function of a viral GCR homolog in vivo.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).