271 resultados para Gene Induction
Resumo:
Because CD4(+) T cells play a key role in aiding cellular immune responses, we wanted to assess whether increasing numbers of gene-engineered antigen-restricted CD4(+) T cells could enhance an antitumor response mediated by similarly gene-engineered CD8(+) T cells. In this study, we have used retroviral transduction to generate erbB2-reactive mouse T-cell populations composed of various proportions of CD4(+) and CD8(+) cells and then determined the antitumor reactivity of these mixtures. Gene-modified CD4(+) and CD8(+) T cells were shown to specifically secrete Tc1 (T cytotoxic-1) or Tc2 cytokines, proliferate, and lyse erbB2(+) tumor targets following antigen ligation in vitro. In adoptive transfer experiments using severe combined immunodeficient (scid) mice, we demonstrated that injection of equivalent numbers of antigen-specific engineered CD8(+) and CD4(+) T cells led to significant improvement in survival of mice bearing established lung metastases compared with transfer of unfractionated (largely CD8(+)) engineered T cells. Transferred CD4(+) T cells had to be antigen-specific (not just activated) and secrete interferon gamma (IFN-gamma) to potentiate the antitumor effect. Importantly, antitumor responses in these mice correlated with localization and persistence of gene-engineered T cells at the tumor site. Strikingly, mice that survived primary tumor challenge could reject a subsequent re-challenge. Overall, this study has highlighted the therapeutic potential of using combined transfer of antigen-specific gene-modified CD8(+) and CD4(+) T cells to significantly enhance T-cell adoptive transfer strategies for cancer therapy.
Resumo:
No abstract
Resumo:
Myb is a key transcription factor that can regulate proliferation, differentiation, and apoptosis, predominantly in the haemopoietic system. Abnormal expression of Myb is associated with a number of cancers, both haemopoietic and non-haemopoietic. In order to better understand the role of Myb in normal and tumorigenic processes, we undertook a cDNA array screen to identify genes that are regulated by this factor. In this way, we identified the gene encoding vascular endothelial growth factor (VEGF) as being potentially regulated by the Myb oncoprotein in myeloid cells. To determine whether this was a direct effect on VEGF gene transcription, we examined the activity of the murine VEGF promoter in the presence of either wild-type (WT) or mutant forms of Myb. It was found that WT Myb was able to activate the VEGF promoter and that a minimal promoter region of 120 bp was sufficient to confer Myb responsiveness. Surprisingly, activation of the VEGF promoter was independent of DNA binding by Myb. This was shown by the use of DNA binding-defective Myb mutants and by mutagenesis of a potential Myb-binding site in the minimal promoter. Mutation of Sp1 sites within this region abolished Myb-mediated regulation of a reporter construct, suggesting that Myb DNA binding-independent activation of VEGF expression occurs via these Sp1 binding elements. Regulation of VEGF production by Myb has implications for the potential role of Myb in myeloid leukaemias and in solid tumours where VEGF may be functioning as an autocrine growth factor. (c) 2006 Elsevier Inc. All rights reserved.
Resumo:
An efficient system is now in place for improving diverse sugarcane cultivars by genetic transformation, that is, the insertion of useful new genes into single cells followed by the regeneration of genetically modified (transgenic) plants. The method has already been used to introduce genes for resistance to several major diseases, insect pests and a herbicide, Field testing has begun, and research is underway to identify other genes for increased environmental stress resistance, agronomic efficiency and yield of sucrose or other valuable products. Experience in other crops has shown that genetically improved varieties which provide genuine environmental and consumer benefits are welcomed by producers and consumers. Substantial research is still needed, but these new gene technologies will reshape the sugar industry and determine the international competitive efficiency of producers.
Resumo:
The genetic mechanisms responsible for the formation of adrenocortical adenomas which autonomously produce aldosterone are largely unknown, The adrenal renin-angiotensin system has been implicated in the pathophysiology of these tumours, Angiotensin-converting enzyme (ACE) catalyses the generation of angiotensin II, and the insertion/deletion (I/D) polymorphism of the ACE gene regulates up to 50% of plasma and cellular ACE variability in humans. We therefore examined the genotypic and allelic frequency distributions of the ACE gene I/D polymorphism in 55 patients with aldosterone-producing adenoma, APA, (angiotensin-unresponsive APA n = 28, angiotensin-responsive APA n = 27), and 80 control subjects with no family history of hypertension, We also compared the ACE gene I/D polymorphism allelic pattern in matched tumour and peripheral blood DNA in the 55 patients with APA, The frequency of the D allele was 0.518 and 0.512 and the I allele was 0.482 and 0.488 in the APA and control subjects respectively, Genotypic and allelic frequency analysis found no significant differences between the groups, Examination of the matched tumour and peripheral blood DNA samples revealed the loss of the insertion allele in four of the 25 patients who were heterozygous for the ACE I/D genotype. The I/D polymorphism of the ACE gene does not appear to contribute to the biochemical and phenotypic characteristics of APA, however, the deletion of the insertion allele of the ACE gene I/D polymorphism in 16% of aldosterone-producing adenomas may represent the loss of a tumour suppressor gene/s or other genes on chromosome 17q which may contribute to tumorigenesis in APA.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Increased Kt concentration in seawater induces metamorphosis in the ascidian Herdmania momus. Larvae cultivated at 24 degrees C exhibit highest rates of metamorphosis when treated with 40 mM KCl-elevated seawater at 21 degrees C. At 24 degrees C, H. momus larvae develop competence to respond to KCl-seawater and initiate metamorphosis approximately 3 h after hatching. Larval trunks and tails separated from the anterior papillae region, but maintained in a common tunic at a distance of greater than 60 mu m, do not undergo metamorphosis when treated with KCl-seawater; normal muscle degradation does not occur in separated tails while ampullae develop from papillae-containing anterior fragments. Normal programmed degradation of myofibrils occurs when posterior fragments are fused to papillae-containing anterior fragments. These data indicate that H. momus settlement and metamorphosis only occurs when larvae have attained competence, and suggest that an anterior signalling centre is stimulated to release a factor that induces metamorphosis.
Resumo:
Homocystinuria, due to a deficiency of the enzyme cystathionine beta-synthase (CBS), is an inborn error of sulphur-amino acid metabolism, This is an autosomal recessive disease which results in hyperhomocysteinaemia and a wide range of clinical features, including optic lens dislocation, mental retardation, skeletal abnormalities and premature thrombotic events, We report the identification of 5 missense mutations in the protein-coding region of the CBS gene from 3 patients with pyridoxine-nonresponsive homocystinuria. Reverse-transcription PCR was used to amplify CBS cDNA from each patient and the coding region was analysed by direct sequencing, The mutations detected included 3 novel (1058C --> T, 992C --> A and 1316G --> A) and 2 previously identified (430G --> A and 833C --> T) base alterations in the CBS cDNA, Each of these mutations predicts a single amino acid substitution in the CBS polypeptide, Appropriate cassettes of patient CBS cDNA, containing each of the above defined mutations, were used to replace the corresponding cassettes of normal CBS cDNA sequence within the bacterial expression vector pT7-7. These recombinant mutant and normal CBS constructs were expressed in Escherichia coli cells and the catalytic activities of the mutant proteins were compared with normal. All of the mutant proteins exhibited decreased catalytic activity in vitro, which confirmed the association between the individual mutation and CBS dysfunction in each patient.
Resumo:
We have isolated a homeobox-containing cDNA from the gastropod mollusc Haliotis rufescens that is most similar to members of the Mox homeobox gene class, The derived Haliotis homeodomain sequence is 85% identical to mouse and frog Mox-2 homeodomains and 88.9% identical to the partial cnidarian cnox5-Hm homeodomain. Quantitative reverse transcription-polymerase chain reaction analysis of mRNA accumulation reveals that this gene, called HruMox, is expressed in the larva, but not in the early embryo, Transcripts are most prevalent during larval morphogenesis from trochophore to veliger. There are also transient increases in transcript prevalence 1 and 3 days after the intitiation of metamorphosis from veliger to juvenile. The identification of a molluscan Mox homeobox gene that is more closely related to vertebrate genes than other protostome (e.g. Drosophila) genes suggests the Mox class of homeobox genes may consist of several different families that have been conserved through evolution, (C) 1997 Federation of European Biochemical Societies.
Resumo:
Familial Mediterranean fever (FMF) is a recessively inherited disorder characterized by dramatic episodes of fever and serosal inflammation. This report describes the cloning of the gene likely to cause FMF from a 115-kb candidate interval on chromosome 16p. Three different missense mutations were identified in affected individuals, but not in normals. Haplotype and mutational analyses disclosed ancestral relationships among carrier chromosomes in populations that have been separated for centuries. The novel gene encodes a 3.7-kb transcript that is almost exclusively expressed in granulocytes. The predicted protein, pyrin, is a member of a family of nuclear factors homologous to the Ro52 autoantigen. The cloning of the FMF gene promises to shed light on the regulation of acute inflammatory responses.
Resumo:
Albicidin phytotoxins are pathogenicity factors in a devastating disease of sugarcane known as leaf scald, caused by Xanthomonas albilineans. A gene (albD) from Pantoea dispersa has been cloned and sequenced and been shown to code for a peptide of 235 amino acids that detoxifies albicidin, The gene shows no significant homology at the DNA or protein level to any known sequence, but the gene product contains a GxSxG motif that is conserved in serine hydrolases, The AlbD protein, purified to homogeneity by means of a glutathione S-transferase gene fusion system, showed strong esterase activity on p-nitrophenyl butyrate and released hydrophilic products during detoxification of albicidins. AlbD hydrolysis of p-nitrophenyl butyrate and detoxification of albicidins required no complex cofactors, Both processes were strongly inhibited by phenylmethylsulfonyl fluoride, a serine enzyme inhibitor, These data strongly suggest that AlbD is an albicidin hydrolase, The enzyme detoxifies albicidins efficiently over a pH range from 5.8 to 8.0, with a broad temperature optimum from 15 to 35 degrees C, Expression of albD in transformed X. albilineans strains abolished the capacity to release albicidin toxins and to incite disease symptoms in sugarcane, The gene is a promising candidate for transfer into sugarcane to confer a form of disease resistance.