Physico-chemical characterization and synthesis of neuronally active alpha-conotoxins

The high speciFIcity of alpha-conotoxins for different neuronal nicotinic acetylcholine receptors makes them important probes for dissecting receptor subtype selectivity. New sequences continue to expand the diversity and utility of the pool of available alpha-conotoxins. Their identification and characterization depend on a suite of techniques with increasing emphasis on mass spectrometry and microscale chromatography, which have benefited from recent advances in resolution and capability. Rigorous physicochemical analysis together with synthetic peptide chemistry is a prerequisite for detailed conformational analysis and to provide sufficient quantities of alpha-conotoxins for activity assessment and structure-activity relationship studies.

Folate-sensitive fragile site FRA10A is due to an expansion of a CGG repeat in a novel gene, FRA10AC1, encoding a nuclear protein

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Bioprocess-centered molecular design (BMD) for the efficient production of an interfacially active peptide

The efficient expression and purification of an interfacially active peptide (mLac21) was achieved by using bioprocess-centered molecular design (BMD), wherein key bioprocess considerations are addressed during the initial molecular biology work. The 21 amino acid mLac21 peptide sequence is derived from the lac repressor protein and is shown to have high affinity for the oil-water interface, causing a substantial reduction in interfacial tension following adsorption. The DNA coding for the peptide sequence was cloned into a modified pET-31(b) vector to permit the expression of mLac21 as a fusion to ketosteroid isomerase (KSI). Rational iterative molecular design, taking into account the need for a scaleable bioprocess flowsheet, led to a simple and efficient bioprocess yielding mLac21 at 86% purity following ion exchange chromatography (and >98% following chromatographic polishing). This case study demonstrates that it is possible to produce acceptably pure peptide for potential commodity applications using common scaleable bioprocess unit operations. Moreover, it is shown that BMD is a powerful strategy that can be deployed to reduce bioseparation complexity. (C) 2004 Wiley Periodicals, Inc.

Super-CHO - A cell line capable of autocrine growth under fully defined protein-free conditions

Chinese Hamster Ovary (CHO) cells are widely used for the large scale production of recombinant biopharmaceuticals. Growth of the CHO-K1 cell line has been demonstrated in serum-free medium containing insulin, transferrin and selenium. In an attempt to get autocrine growth in protein-free medium, DNA coding for insulin and transferrin production was transfected into CHO-K1 cells. Transferrin was expressed well, with clones secreting approximately 1000 ng/10(6)cells/24h. Insulin was poorly expressed, with rates peaking at 5 ng/10(6)cells/24h. Characterisation of the secreted insulin indicated that the CHO cells were incompletely processing the insulin molecule. Site-directed mutagenesis was used to introduce a furin (prohormone converting enzyme) recognition sequence into the insulin molecule, allowing the production of active insulin. However, the levels were still too low to support autocrine growth. Further investigations revealed insulin degrading activity (presumably due to the presence of insulin degrading enzymes) in the cytoplasm of CHO cells. To overcome these problems insulin-like growth factor I (instead of insulin) was transfected into the cells. IGF-1 was completely processed and expressed at rates greater than 500 ng/10(6)cells/24h. In this paper we report autonomous growth of the transfected CHO-K1 cell line expressing transferrin and IGF-1 in protein-free medium without the addition of exogenous growth factors. Growth rates and final cell densities of these cells were identical to that of the parent cell line CHO-K1 growing in insulin, transferrin, and selenium supplemented serum-free media.

Regulation of CSF-1 receptor expression

Cells of the mononuclear phagocyte lineage possess receptors for macrophage colony-stimulating factor (CSF-1) encoded by the c-fms protooncogene and respond to CSF-1 with increased survival, growth, differentiation, and reversible changes in function. The c-fms gene is itself a macrophage differentiation marker. In whole mount analyses of mRNA expression in embryos, c-fms is expressed at very high levels on placental trophoblasts. It is detectable on individual cells in the yolk sac around 8.5 to 9 days postcoitus, appears on isolated cells in the head of the embryo around 9.5 dpc, and appears on numerous cells throughout the embryo by day 10.5. The extent of c-fms expression is much greater than for other macrophage-specific genes including lysozyme and a macrophage-specific protein tyrosine phosphatase. Our studies of the cis-acting elements of the c-fms promoter have indicated a key role for collaboration between the macrophage-specific transcription factor, Pu.1, which functions in determining the site of transcription initiation, and other members of the Ets transcription factor family. This is emerging as a common pattern in macrophage-specific promoters. We have shown that two PU box elements alone can function as a macrophage-specific promoter. The activity of both the artifical promoter and the c-fms promoter is activated synergistically by coexpression of Pu.1 and another Ets factor, c-Ets-2. A 3.5kb c-fms exon 2 promoter (but not the 300bp proximal promoter) is also active in a wide diversity of tumor cell lines. The interesting exception is the melanoma cell line K1735, in which the promoter is completely shut down and expression of c-fms causes growth arrest and cell death. The activity of the exon 2 promoter in these nonmacrophages is at least as serum responsive as the classic serum-responsive promoter of the c-fos gene. It is further inducible in nonmacrophages by coexpression of the c-fms product. Unlike other CSF-1/c-fms-responsive promoters, the c-fms promoter is not responsive to activated Ras even when c-Ets-2 is coexpressed. In most lines, production of full length c-fms is prevented by a downstream intronic terminator, but in Lewis lung carcinoma, read-through does occur, and expression of both c-fms and other macrophage-specific genes such as lysozyme and urokinase becomes detectable in conditions of serum deprivation. (C) 1997 Wiley-Liss, Inc.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).