223 resultados para multiple locus sequence typing


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: The fact that some cancers and viral infections can be controlled by effector CD8 T cells led to the possibility of utilising minimal CD8 T cell epitope peptides as vaccines. However using minimal CD8 T cell epitope peptide immunisations and a tumour protection model in mice, we have previously shown that functional memory CD8 T cells are not generated unless CD4 T help is provided at the time of CD8 T cell priming. Short-lived effector cells nevertheless are generated in the absence of T help. Aim: To determine the role of CD4 T help in multiple immunisations. Method: Minimal CD8 T cell peptides of HPV16 E7 protein and Ovalbumin were used (with adjuvants Quil-A or IFA) as immunogens in C57BL mice. The presence of effector CD8 T cells were determined by tumour protection assays and was quantified by IFN-gamma ELISPOT assays. Results: In the present study we show that unless T help is provided at the time CD8 T cells are primed, no CD8 effector cells are generated when boosted with the vaccine again in the absence of T help. Our results further show that this failure could be prevented by the inclusion of a T helper peptide during the primary or booster immunisations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The technical reliability (i.e., interinstrument and interoperator reliability) of three SEAC-swept frequency bioimpedance monitors was assessed for both errors of measurement and associated analyses. In addition, intraoperator and intrainstrument variability was evaluated for repeat measures over a 4-hour period. The measured impedance values from a range of resistance-capacitance circuits were accurate to within 3% of theoretical values over a range of 50-800 ohms. Similarly, phase was measured over the range 1 degrees-19 degrees with a maximum deviation of 1.3 degrees from the theoretical value. The extrapolated impedance at zero frequency was equally well determined (+/-3%). However, the accuracy of the extrapolated value at infinite frequency was decreased, particularly at impedances below 50 ohms (approaching the lower limit of the measurement range of the instrument). The interinstrument/operator variation for whole body measurements were recorded on human volunteers with biases of less than +/-1% for measured impedance values and less than 3% for phase. The variation in the extrapolated values of impedance at zero and infinite frequencies included variations due to operator choice of the analysis parameters but was still less than +/-0.5%. (C) 1997 Wiley-Liss, Inc.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The class II major histocompatibility complex molecule I-A(g7) is strongly linked to the development of spontaneous insulin-dependent diabetes mellitus (IDDM) in non obese diabetic mice and to the induction of experimental allergic encephalomyelitis in Biozzi AB/H mice. Structurally, it resembles the HLA-DQ molecules associated with human IDDM, in having a non-Asp residue at position 57 in its beta chain. To identify the requirements for peptide binding to I-A(g7) and thereby potentially pathogenic T cell epitopes, we analyzed a known I-A(g7)-restricted T cell epitope, hen egg white lysozyme (HEL) amino acids 9-27. NH2- and COOH-terminal truncations demonstrated that the minimal epitope for activation of the T cell hybridoma 2D12.1 was M12-R21 and the minimum sequence for direct binding to purified I-A(g7) M12-Y20/K13-R21. Alanine (A) scanning revealed two primary anchors for binding at relative positions (p) 6 (L) and 9 (Y) in the HEL epitope. The critical role of both anchors was demonstrated by incorporating L and Y in poly(A) backbones at the same relative positions as in the HEL epitope. Well-tolerated, weakly tolerated, and nontolerated residues were identified by analyzing the binding of peptides containing multiple substitutions at individual positions. Optimally, p6 was a large, hydrophobic residue (L, I, V, M), whereas p9 was aromatic and hydrophobic (Y or F) or positively charged (K, R). Specific residues were not tolerated at these and some other positions. A motif for binding to I-A(g7) deduced from analysis of the model HEL epitope was present in 27/30 (90%) of peptides reported to be I-A(g7)-restricted T cell epitopes or eluted from I-A(g7). Scanning a set of overlapping peptides encompassing human proinsulin revealed the motif in 6/6 good binders (sensitivity = 100%) and 4/13 weak or non-binders (specificity = 70%). This motif should facilitate identification of autoantigenic epitopes relevant to the pathogenesis and immunotherapy of IDDM.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective. Circumstantial evidence links retroviruses (RVs) with human autoimmune diseases, The aim of the present study was to obtain direct evidence of RV gene expression in rheumatoid arthritis (RA). Methods. Synovial samples were obtained from patients with RA, patients with osteoarthritis (OA), and normal control subjects, Reverse transcription-polymerase chain reaction (RT-PCR) was performed using synovial RNA and primers to conserved sequences in the polymerase (pol) genes of known RVs. Results. PCR products (n = 857) were cloned and sequenced, Multiple pol transcripts, many with open reading frames, were expressed in every sample, Sequences were aligned and classified into 6 families (F1-F6) that contained 33 groups of known and unknown endogenous RVs (ERVs), each distinguished by a specific, deduced peptide motif, The frequency of sequences in each family was similar between RA, OA, and normal synovial tissue, but differed significantly in RA synovial fluid cells, F1 sequences (undefined, but related to murine and primate type C RVs) were lower in frequency, F2 (ERV-9-related), F4 (HERV-K-related), and F6 (HERV-L-related) sequences were higher in frequency, and F3 (RTVL-H-related) sequences were not detected, in the RA synovial fluid cells compared with the RA synovial tissues. Conclusion. Multiple ERVs are expressed in normal and diseased synovial compartments, but specific transcripts can be differentially expressed in RA.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cell-wall polysaccharides from six species of red algae of the genus Callophycus were mainly galactans comprised predominantly of galactose (Gal) and 3,6-anhydrogalactose (AnGal), and were rich in pyruvate and sulfate. The Fourier Transform Infrared (FTIR) spectra of the polysaccharides superficially resembled that of alpha-carrageenan (composed of the repeating disaccharide carrabiose 2-sulfate), with major bands of absorption indicative of if-linked AnGal, axial 2-sulfate on 4-linked AnGal, and unsulfated, 3-linked Gal. The FTIR spectra of solutions of Callophycus polysaccharides in D2O-phosphate buffer displayed absorption, corresponding to the carboxylate anion of the pyruvate acetal substituent. Methylation analysis showed that 3,4,6-linked Galp (interpreted as 4,6-pyruvated, 3-linked Galp) and 2,4-linked AnGalp (interpreted as 4-linked AnGalp 2-sulfate) were the dominant links, together with significant quantities of 3-linked Galp. Proton-decoupled C-13 nuclear magnetic resonance (NMR) spectroscopy showed the polysaccharides to be composed predominantly of pyruvated carrageenans. The C-13 NMR spectra were completely assigned by a J-modulated spin-echo pulse sequence and 2D experiments employing gradient Heteronuclear Multiple Bond Correlation (HMBC), C-13/H-1 Heteronuclear Multiple Quantum Coherence (HMQC), and HMQC Total Correlation Spectroscopy (HMQC-TOCSY). The Callophycus galactans thus consist predominantly of the novel repeating disaccharide 4',6'-O-(1-carboxyethylidene)carrabiose 2-sulfate and minor amounts of the alpha-carrageenan repeating unit (carrabiose 2-sulfate), and other structural variations. (C) 1997 Elsevier Science Ltd.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this paper we describe the assembly and restriction map of a 1.05-Mb cosmid contig spanning the candidate region for familial Mediterranean fever (FMF), a recessively inherited disorder of inflammation localized to 16p13.3. Using a combination of cosmid walking and screening for P1, PAC, BAG, and YAC clones, we have generated a contig of genomic clones spanning similar to 1050 kb that contains the FMF critical region. The map consists of 179 cosmid, 15 P1, 10 PAC, 3 BAG, and 17 YAC clones, anchored by 27 STS markers. Eight additional STSs have been developed from the similar to 700 kb immediately centromeric to this genomic region. Five of the 35 STSs are microsatellites that have not been previously reported. NotI and EcoRI mapping of the overlapping cosmids, hybridization of restriction fragments from cosmids to one another, and STS analyses have been used to validate the assembly of the contig. Our contig totally subsumes the 250-kb interval recently reported, by founder haplotype analysis, to contain the FMF gene. Thus, our high-resolution clone map provides an ideal resource for transcriptional mapping toward the eventual identification of this disease gene. (C) 1997 Academic Press.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study examined the utility of self-efficacy as a predictor of social activity and mood control in multiple sclerosis (MS). Seventy-one subjects with MS were recruited from people attending an MS centre or from a mailing list and were examined on two occasions that were two months apart. Clinic patients were more disabled than patients who completed assessments by post, but they were of higher socioeconomic status and were less dysphoric; We attempted to predict self-reported performance of mood control and social activity at two months, from self-efficacy or performance on these tasks at pretest. Demographic variables, disorder status, disability, self-esteem and depression were also allowed to compete for entry into multiple regressions. Substantial stability in mood, performance and disability was observed over the two months. In both mood control and social activity, past performance was the strongest predictor of later performance, but self-efficacy also contributed significantly to the prediction. The disability level entered a prediction of social activity; but no other variables predicted either type of performance. A secondary analysis predicting self-esteem at two months also included self-efficacy for social activity, illustrating the contribution of perceived capability to later assessments of self-worth. The study provided support for self-efficacy as a predictor of later behavioural outcomes and self-esteem in multiple sclerosis. (C) 1997 Elsevier Science Ltd.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We have previously shown that H-1 pulsed-field-gradient (PFG) NMR spectroscopy provides a facile method for monitoring protein self-association and can be used, albeit with some caveats, to measure the apparent molecular mass of the diffusant [Dingley et al. (1995) J. Biomol. NMR, 6, 321-328]. In this paper we show that, for N-15-labelled proteins, selection of H-1-N-15 multiple-quantum (MQ) coherences in PFG diffusion experiments provides several advantages over monitoring H-1 single-quantum (SQ) magnetization. First, the use of a gradient-selected MQ filter provides a convenient means of suppressing resonances from both the solvent and unlabelled solutes. Second, H-1-N-15 zero-quantum coherence dephases more rapidly than H-1 SQ coherence under the influence of a PFG. This allows the diffusion coefficients of larger proteins to be measured more readily. Alternatively, the gradient length and/or the diffusion delay may be decreased, thereby reducing signal losses from relaxation. In order to extend the size of macromolecules to which these experiments can be applied, we have developed a new MQ PFG diffusion experiment in which the magnetization is stored as longitudinal two-spin order for most of the diffusion period, thus minimizing sensitivity losses due to transverse relaxation and J-coupling evolution.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We describe a method for multiple indicator dilution studies in the isolated perfused human placental lobule developed to investigate the relationships between changes in pressure and flow and solute clearance. A peripheral lobule of a human placenta is perfused with a tissue culture-based medium and the perfusate oxygen tension, arterial and venous pressures, pH and perfusion temperature continuously monitored by a computerized system. Flow rates are readily changed. Bolus injections of vascular, extracellular and water space markers, and study compounds can be made into either maternal or fetal circulations, and precisely timed outflow fractions can be collected with computer-controlled fraction collectors, allowing simultaneous determination of concentration-time profiles of each marker. (C) 1997 Elsevier Science Inc.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The identification of genes responsible for the rare cases of familial leukemia may afford insight into the mechanism underlying the more common sporadic occurrences. Here we test a single family with 11 relevant meioses transmitting autosomal dominant acute myelogenous leukemia (AML) and myelodysplasia for linkage to three potential candidate loci. In a different family with inherited AML, linkage to chromosome 21q22.1-22.2 was recently reported; we exclude linkage to 21q22.1-22.2, demonstrating that familial AML is a heterogeneous disease. After reviewing familial leukemia and observing anticipation in the form of a declining age of onset with each generation, we had proposed 9p21-22 and 16q22 as additional candidate loci. Whereas linkage to 9p21-22 can be excluded, the finding of a maximum two-point LOD score of 2.82 with the microsatellite marker D16S522 at a recombination fraction theta = 0 provides evidence supporting linkage to 16q22. Haplotype analysis reveals a 23.5-cM (17.9-Mb) commonly inherited region among all affected family members extending from D16S451 to D1GS289, In order to extract maximum linkage information with missing individuals, incomplete informativeness with individual markers in this interval, and possible deviance from strict autosomal dominant inheritance, we performed nonparametric linkage analysis (NPL) and found a maximum NPL statistic corresponding to a P-value of .00098, close to the maximum conditional probability of linkage expected for a pedigree with this structure. Mutational analysis in this region specifically excludes expansion of the AT-rich minisatellite repeat FRA16B fragile site and the CAG trinucleotide repeat in the E2F-4 transcription factor. The ''repeat expansion detection'' method, capable of detecting dynamic mutation associated with anticipation, more generally excludes large CAG repeat expansion as a cause of leukemia in this family.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The outflow-concentration-time profiles for lignocaine (lidocaine) and its metabolites have been measured after bolus impulse administration of [C-14]lignocaine into the perfused rat liver. Livers from female Sprague-Dawley rats were perfused in a once-through fashion with red-blood-cell-free Krebs-Henseleit buffer containing 0 or 2% bovine serum albumin. Perfusate flow rates of 20 and 30 mL min(-1) were used and both normal and retrograde flow directions were employed. Significant amounts of metabolite were detected in the effluent perfusate soon after lignocaine injection. The early appearance of metabolite contributed to bimodal outflow profiles observed for total C-14 radioactivity. The lignocaine outflow profiles were well characterized by the two-compartment dispersion model, with efflux rate << influx rate. The profiles for lignocaine metabolites were also characterized in terms of a simplified two-compartment dispersion model. Lignocaine was found to be extensively metabolized under the experimental conditions with the hepatic availability ranging between 0.09 and 0.18. Generally lignocaine and metabolite availability showed no significant change with alterations in perfusate flow rate from 20 to 30 mt min(-1) or protein content from 0 to 2%. A significant increase in lignocaine availability occurred when 1200 mu M unlabelled lignocaine was added to the perfusate. Solute mean transit times generally decreased with increasing flow rate and with increasing perfusate protein content. The results confirm that lignocaine pharmacokinetics in the liver closely follow the predictions of the well-stirred model. The increase in lignocaine availability when 1200 mu M unlabelled lignocaine was added to the perfusate is consistent with saturation of the hydroxylation metabolic pathways of lignocaine metabolism.