284 resultados para Variable Expression


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The role of thymic versus peripheral epithelial cells in the negative selection of the peptide-specific CD8 T cell repertoire is still largely unresolved. We have generated TCRb chain transgenic mice in which 20–35% of peripheral CD8 T cells recognize an epitope from a viral, nuclear oncoprotein (human papillomavirus type 16 E7) in the context ofMHC class I, H-2Db. When T cells from these transgenic mice develop through the thymus of a second transgenic mouse expressing E7 from a keratin 14 promoter, no major perturbation to thymic T cell development is observed over a 7 month period. In contrast, peripheral CD8 T cell responses in these same mice (E7TCRxK14E7 double transgenic) become reduced over time. This data suggests that peripheral tolerance mechanisms predominate over thymic negative selection in controlling CD8 T cell responses to this epithelial, nuclear oncoprotein.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Eccentric exercise commonly results in muscle damage. The primary sequence of events leading to exercise-induced muscle damage is believed to involve initial mechanical disruption of sarcomeres, followed by impaired excitation-contraction coupling and calcium signaling, and finally, activation of calcium-sensitive degradation pathways. Muscle damage is characterized by ultrastructural changes to muscle architecture, increased muscle proteins and enzymes in the bloodstream, loss of muscular strength and range of motion and muscle soreness. The inflammatory response to exercise-induced muscle damage is characterized by leukocyte infiltration and production of pro-inflammatory cytokines within damaged muscle tissue, systemic release of leukocytes and cytokines, in addition to alterations in leukocyte receptor expression and functional activity. Current evidence suggests that inflammatory responses to muscle damage are dependent on the type of eccentric exercise, previous eccentric loading (repeated bouts), age and gender. Circulating neutrophil counts and systemic cytokine responses are greater after eccentric exercise using a large muscle mass (e.g. downhill running, eccentric cycling) than after other types of eccentric exercise involving a smaller muscle mass. After an initial bout of eccentric exercise, circulating leukocyte counts and cell surface receptor expression are attenuated. Leukocyte and cytokine responses to eccentric exercise are impaired in elderly individuals, while cellular infiltration into skeletal muscle is greater in human females than males after eccentric exercise. Whether alterations in intracellular calcium homeostasis influence inflammatory responses to muscle damage is uncertain. Furthermore, the effects of antioxidant supplements are variable, and the limited data available indicates that anti-inflammatory drugs largely have no influence on inflammatory responses to eccentric exercise. In this review, we compare local versus systemic inflammatory responses, and discuss some of the possible mechanisms regulating the inflammatory responses to exercise-induced muscle damage in humans.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

PHWAT is a new model that couples a geochemical reaction model (PHREEQC-2) with a density-dependent groundwater flow and solute transport model (SEAWAT) using the split-operator approach. PHWAT was developed to simulate multi-component reactive transport in variable density groundwater flow. Fluid density in PHWAT depends not on only the concentration of a single species as in SEAWAT, but also the concentrations of other dissolved chemicals that can be subject to reactive processes. Simulation results of PHWAT and PHREEQC-2 were compared in their predictions of effluent concentration from a column experiment. Both models produced identical results, showing that PHWAT has correctly coupled the sub-packages. PHWAT was then applied to the simulation of a tank experiment in which seawater intrusion was accompanied by cation exchange. The density dependence of the intrusion and the snow-plough effect in the breakthrough curves were reflected in the model simulations, which were in good agreement with the measured breakthrough data. Comparison simulations that, in turn, excluded density effects and reactions allowed us to quantify the marked effect of ignoring these processes. Next, we explored numerical issues involved in the practical application of PHWAT using the example of a dense plume flowing into a tank containing fresh water. It was shown that PHWAT could model physically unstable flow and that numerical instabilities were suppressed. Physical instability developed in the model in accordance with the increase of the modified Rayleigh number for density-dependent flow, in agreement with previous research. (c) 2004 Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cells of the mononuclear phagocyte lineage possess receptors for macrophage colony-stimulating factor (CSF-1) encoded by the c-fms protooncogene and respond to CSF-1 with increased survival, growth, differentiation, and reversible changes in function. The c-fms gene is itself a macrophage differentiation marker. In whole mount analyses of mRNA expression in embryos, c-fms is expressed at very high levels on placental trophoblasts. It is detectable on individual cells in the yolk sac around 8.5 to 9 days postcoitus, appears on isolated cells in the head of the embryo around 9.5 dpc, and appears on numerous cells throughout the embryo by day 10.5. The extent of c-fms expression is much greater than for other macrophage-specific genes including lysozyme and a macrophage-specific protein tyrosine phosphatase. Our studies of the cis-acting elements of the c-fms promoter have indicated a key role for collaboration between the macrophage-specific transcription factor, Pu.1, which functions in determining the site of transcription initiation, and other members of the Ets transcription factor family. This is emerging as a common pattern in macrophage-specific promoters. We have shown that two PU box elements alone can function as a macrophage-specific promoter. The activity of both the artifical promoter and the c-fms promoter is activated synergistically by coexpression of Pu.1 and another Ets factor, c-Ets-2. A 3.5kb c-fms exon 2 promoter (but not the 300bp proximal promoter) is also active in a wide diversity of tumor cell lines. The interesting exception is the melanoma cell line K1735, in which the promoter is completely shut down and expression of c-fms causes growth arrest and cell death. The activity of the exon 2 promoter in these nonmacrophages is at least as serum responsive as the classic serum-responsive promoter of the c-fos gene. It is further inducible in nonmacrophages by coexpression of the c-fms product. Unlike other CSF-1/c-fms-responsive promoters, the c-fms promoter is not responsive to activated Ras even when c-Ets-2 is coexpressed. In most lines, production of full length c-fms is prevented by a downstream intronic terminator, but in Lewis lung carcinoma, read-through does occur, and expression of both c-fms and other macrophage-specific genes such as lysozyme and urokinase becomes detectable in conditions of serum deprivation. (C) 1997 Wiley-Liss, Inc.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Phytophthora-resistant lucerne cultivars do not always perform well under conditions of high disease pressure in the field. To determine whether resistance expression remains stable under different infection intensities, tetraploid and diploid lucerne genotypes, genotypically defined for their reactions to Phytophthora medicaginis, were clonally propagated, and the influence of different reproducible inoculum levels (0 . 5 and 5 . 0 g dry weight mycelium/kg dry weight potting mix), the period of exposure to these levels (10-60 days), and temperature (16/22 degrees C and 24/30 degrees C) on disease expression was determined in controlled environments. Generally, expression of resistance by resistant genotypes, remained stable under these conditions. Biotic (e.g. Aphanomyces eutiches) or abiotic factors other than P. medicaginis may be responsible for the poorer than expected performance under field conditions in some instances, or the percentage of resistant plants in some cultivars currently classified as resistant is insufficient to provide buffering against productivity reductions under severe epidemics. Further research is needed to clarify the situation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective. Circumstantial evidence links retroviruses (RVs) with human autoimmune diseases, The aim of the present study was to obtain direct evidence of RV gene expression in rheumatoid arthritis (RA). Methods. Synovial samples were obtained from patients with RA, patients with osteoarthritis (OA), and normal control subjects, Reverse transcription-polymerase chain reaction (RT-PCR) was performed using synovial RNA and primers to conserved sequences in the polymerase (pol) genes of known RVs. Results. PCR products (n = 857) were cloned and sequenced, Multiple pol transcripts, many with open reading frames, were expressed in every sample, Sequences were aligned and classified into 6 families (F1-F6) that contained 33 groups of known and unknown endogenous RVs (ERVs), each distinguished by a specific, deduced peptide motif, The frequency of sequences in each family was similar between RA, OA, and normal synovial tissue, but differed significantly in RA synovial fluid cells, F1 sequences (undefined, but related to murine and primate type C RVs) were lower in frequency, F2 (ERV-9-related), F4 (HERV-K-related), and F6 (HERV-L-related) sequences were higher in frequency, and F3 (RTVL-H-related) sequences were not detected, in the RA synovial fluid cells compared with the RA synovial tissues. Conclusion. Multiple ERVs are expressed in normal and diseased synovial compartments, but specific transcripts can be differentially expressed in RA.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We have studied gene expression during ascidian embryonic development using the technique of differential display and isolated partial cDNA sequences of 12 genes. Developmental regulation of these genes has been confirmed by northern hybridization analysis. Further cDNA cloning and sequence analysis of an mRNA that is present during gastrulation, neurulation and tailbud formation reveals that it encodes a novel serine protease containing a single kringle motif and catalytic domain. The spatial expression of this gene, designated Hmserp1, is restricted to precursor cells of the epidermis. The structure and expression of Hmsery1 is discussed in relation to possible functions during development.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The spatial and temporal association of muscle-specific tropomyosin gene expression, and myofibril assembly and degradation during metamorphosis is analyzed in the gastropod mollusc. Haliotis rufescens. Metamorphosis of tile planktonic larva to the benthic juvenile includes rearrangement and atrophy of specific larval muscles, and biogenesis of the new juvenile muscle system. The major muscle of the larva - the larval retractor muscle - reorganizes at metamorphosis, with two suites of cells having different fates. The ventral cells degenerate, while the dorsal cells become part of the developing juvenile mantle musculature. Prior to these changes in myofibrillar structure, tropomyosin mRNA prevalence declines until undetectable in the ventral cells, while increasing markedly in the dorsal cells. In the foot muscle and right shell muscle, tropomyosin mRNA levels remain relatively stable, even trough myofibril content increases. In a population of median mesoderm cells destined to form de novo the major muscle of the juvenile and adult (the columellar muscle), tropomyosin expression is initiated at 45 h after induction of metamorphosis. Myofibrillar filamentous actin is not detected in these cells until about 7 days later. Given that patterns of tropomyosin mRNA accumulation in relation to myofibril assembly and disassembly differ significantly among the four major muscle systems examined, we suggest that different regulatory mechanisms, probably operating at both transcriptional and post-transcriptional levels, control the biogenesis and atrophy of different larval and postlarval muscles at metamorphosis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In both animal models and humans, the first and obligatory step in the activation of arylamines is N-hydroxylation. This pathway is primarily mediated by the phase-I enzymes CYP1A1, CYP1A2 and CYP4B1. In the presence of flavonoids such as alpha-naphthoflavone and flavone, both CYP3A4 and CYP3A5 have also been shown to play a minor role in the activation of food-derived heterocyclic amines. The further activation of N-hydroxyarylamines by phase-II metabolism can involve both N,O-acetylation and N,O-sulfonation catalyzed by N-acetyltransferases (NAT1 and NAT2) and sulfotransferases, respectively. Using an array of techniques, we have been unable to detect constitutive CYP1A expression in any segments of the human gastrointestinal tract. This is in contrast to the rabbit where CYP1A1 protein was readily detectable on immunoblots in microsomes prepared from the small intestine. In humans, CYP3A3/3A4 expression was detectable in the esophagus and all segments of the small intestine. Northern blot analysis of eleven human colons showed considerable heterogeneity in CYP3A mRNA between individuals, with the presence of two mRNA species in same subjects. Employing the technique of hybridization histochemistry (also known as in situ hybridization), CYP4B1 expression was observed in some human colons but not in the liver or the small intestine. Hybridization histochemistry studies have also demonstrated variable NAT1 and NAT2 expression in the human gastrointestinal tract. NAT1 and NAT2 mRNA expression was detected in the human liver, small intestine, colon, esophagus, bladder, ureter, stomach and lung. Using a general aryl sulfotransferase riboprobe (HAST1), we have demonstrated marked sulfotransferase expression in the human colon, small intestine, lung, stomach and liver. These studies demonstrate that considerable variability exists in the expression of enzymes involved in the activation of aromatic amines in human tissues. The significance of these results in relation to a role for heterocyclic amines in colon cancer is discussed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Elevated concentrations of plasma tumour necrosis factor (TNF)-alpha, interleukin (IL)-1 and IL-6 have been detected in patients with alcoholic hepatitis and have been implicated in the pathogenesis of hepatocyte necrosis. The present study used a rat model to conduct a detailed histological and biochemical examination of the expression of various pro-inflammatory cytokines and associated liver pathology in ethanol-potentiated lipopolysaccharide (LPS)-induced liver injury. Male Wistar rats were pair-fed either the control or ethanol-containing (36% of caloric intake as ethanol) form of the Lieber-DeCarli liquid diet for 6 weeks. Liver injury was induced by the i.v. injection of LPS (1 mu g/g bodyweight), with animals being killed at O, 1, 3, 6, 12 and 24 h after injection. At the later time points, plasma transaminase and transpeptidase activities were significantly elevated in ethanol-fed LPS-treated rats compared with control-fed LPS-treated animals. At these times after LPS treatment, hepatocytes in ethanol-fed animals displayed fatty change and necrosis with an associated neutrophil polymorph infiltrate. Time course analysis revealed that plasma TNF-alpha (1-3 h post-LPS) and IL-6 (3 h post-LPS) bioactivity was significantly elevated in ethanol-fed compared with control-fed animals. No difference was seen in plasma IL-1 alpha concentration (maximal in both groups 6 h post-LPS). The expression of TNF-alpha, IL-1 alpha, IL-1 beta and IL-6 mRNA were elevated between 1 and 6 h post-LPS in the livers of both control and ethanol-fed rats. However, ethanol-fed LPS-treated animals exhibited significantly higher maximal expression of IL-1 and IL-6 mRNA. Comparison of the appearance of cytokine mRNA and plasma bioactivity indicated an effect of ethanol feeding on post-transcriptional processing and/or the kinetics of the circulating cytokines. Elevated levels of both hepatic cytokine mRNA expression and the preceding plasma cytokines are presumably a necessary prerequisite for hepatic injury seen in this model and, therefore, possibly for the damage seen in human alcoholics. Further studies using this model may lead to significant advances in our understanding of the pathogenic mechanisms of alcoholic liver disease in humans.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

H-1 NMR spectra of the thyroid hormone thyroxine recorded at low temperature and high field show splitting into two peaks of the resonance due to the H2,6 protons of the inner (tyrosyl) ring. A single resonance is observed in 600 MHz spectra at temperatures above 185 K. An analysis of the line shape as a function of temperature shows that the coalescence phenomenon is due to an exchange process with a barrier of 37 kJ mol(-1). This is identical to the barrier for coalescence of the H2',6' protons of the outer (phenolic) ring reported previously for the thyroid hormones and their analogues. It is proposed that the separate peaks at low temperature are due to resonances for H2,6 in cisoid and transoid conformers which are populated in approximately equal populations. These two peaks are averaged resonances for the individual H2 and H6 protons. Conversion of cisoid to transoid forms can occur via rotation of either the alanyl side chain or the outer ring, from one face of the inner ring to the other. It is proposed that the latter process is the one responsible for the observed coalescence phenomenon. The barrier to rotation of the alanyl side chain is greater than or equal to 37 kJ mol(-1), which is significantly larger than has previously been reported for Csp(2)-Csp(3) bonds in other Ph-CH2-X systems. The recent crystal structure of a hormone agonist bound to the ligand-binding domain of the rat thyroid hormone receptor (Wagner et al. Nature 1995, 378, 690-697) shows the transoid form to be the bound conformation. The significant energy barrier to cisoid/transoid interconversion determined in the current study combined with the tight fit of the hormone to its receptor suggests that interconversion between the forms cannot occur at the receptor site but that selection for the preferred bound form occurs from the 50% population of the transoid form in solution.