Nutrient-induced perturbations to delta C-13 and delta N-15 in symbiotic dinoilagellates and their coral hosts

Inorganic nutrients play a critical role in determining benthic community structure in tropical seas. This study examined the impact of adding inorganic nutrients (ammonium and phosphate) on the isotopic composition of 2 reef-building corals, Pocillopora damicornis and Heliofungia actiniformis, on the southern Great Barrier Reef. The addition of elevated nutrients to patch reefs that pond at low tide did not perturb the C:N ratio of either species or their symbiotic dinoflagellates. The C:N ratios were significantly higher in material extracted from the skeleton (14.8 +/- 1.50 and 10.8 +/- 1.42) than either host (7.6 +/- 0.87 and 6.0 +/- 0.71) or symbiotic dinoflagellates (5.7 +/- 0.48 and 6.9 +/- 0.66) (P. damicornis and H. actiniformis respectively; 95 confidence intervals). The ratio of acquired N to background N suggests that the added dissolved inorganic nitrogen (DIN) accounted for 50 to 100% of total nitrogen within the tissues of P. damicornis and H. actiniformis at the end of the experiment. The addition of the isotopically depleted nutrients (delta(15) N = 0parts per thousand) to patch reefs significantly decreased delta(15)N from control values of between 3 and 4 to values to below 1 in the case of all compartments, while delta(13)C values were relatively unresponsive to nutrient treatments. These findings suggest that coral delta(15)N has the potential to provide a historical record of the delta(15)N of dissolved nitrogen surrounding reef-building corals and their symbiotic dinoflagellates.

p53 Suppresses c-Myb-induced trans-Activation and Transformation by Recruiting the Corepressor mSin3A

p53 is known to repress transcription of a number of genes, but the mechanism of p53 recruitment to these target genes is unknown. The c-myb proto-oncogene product (c-Myb) positively regulates proliferation of immature hematopoietic cells, whereas p53 blocks cell cycle progression. Here, we demonstrate that p53 inhibits c-Myb-induced transcription and transformation by directly binding to c-Myb. The ability of c-Myb to maintain the undifferentiated state of M1 cells was also suppressed by p53. p53 did not affect the ability of c-Myb to bind to DNA but formed a ternary complex with the corepressor mSin3A and c-Myb. Thus, p53 antagonizes c-Myb by recruiting mSin3A to down-regulate specific Myb target genes.

PREDBALB/c: a system for the prediction of peptide binding to H2(d) molecules, a haplotype of the BALB/c mouse

PREDBALB/c is a computational system that predicts peptides binding to the major histocompatibility complex-2 (H2(d)) of the BALB/c mouse, an important laboratory model organism. The predictions include the complete set of H2(d) class I ( H2-K-d, H2-L-d and H2-D-d) and class II (I-E-d and I-A(d)) molecules. The prediction system utilizes quantitative matrices, which were rigorously validated using experimentally determined binders and non-binders and also by in vivo studies using viral proteins. The prediction performance of PREDBALB/c is of very high accuracy. To our knowledge, this is the first online server for the prediction of peptides binding to a complete set of major histocompatibility complex molecules in a model organism (H2(d) haplotype). PREDBALB/c is available at http://antigen.i2r.a-star.edu.sg/predBalbc/.

A study on stress corrosion cracking and hydrogen embrittlement of AZ31 magnesium alloy

The stress corrosion cracking (SCC) behavior and pre-exposure embrittlement of AZ31 magnesium alloy have been studied by slow strain rate tensile (SSRT) tests in this paper. It is showed that AZ31 sheet material is susceptible to SCC in distilled water, ASTM D1.387 solution, 0.01 M NaCl and 0.1 M NaCl solution. The AZ31 magnesium alloy also becomes embrittled if pre-exposed to 0.01 M NaCl solution prior to tensile testing. The degree of embrittlement increased with increasing the pre-exposure time, It is proposed that both the pre-exposure embrittlement and SCC were due to hydrogen which reduces the cohesive strength. i,e,. hydrogen embrittlement, (c) 2005 Elsevier B.V. All rights reserved.

Identification of novel non-autonomous CemaT transposable elements and evidence of their mobility within the C. elegans genome

We describe here two new transposable elements, CemaT4 and CemaT5, that were identified within the sequenced genome of Caenorhabditis elegans using homology based searches. Five variants of CemaT4 were found, all non-autonomous and sharing 26 bp inverted terminal repeats (ITRs) and segments (152-367 bp) of sequence with similarity to the CemaT1 transposon of C. elegans. Sixteen copies of a short, 30 bp repetitive sequence, comprised entirely of an inverted repeat of the first 15 bp of CemaT4's ITR, were also found, each flanked by TA dinucleotide duplications, which are hallmarks of target site duplications of mariner-Tc transposon transpositions. The CemaT5 transposable element had no similarity to maT elements, except for sharing identical ITR sequences with CemaT3. We provide evidence that CemaT5 and CemaT3 are capable of excising from the C. elegans genome, despite neither transposon being capable of encoding a functional transposase enzyme. Presumably, these two transposons are cross-mobilised by an autonomous transposon that recognises their shared ITRs. The excisions of these and other non-autonomous elements may provide opportunities for abortive gap repair to create internal deletions and/or insert novel sequence within these transposons. The influence of non-autonomous element mobility and structural diversity on genome variation is discussed.

Elevated plasma membrane and sarcoplasmic reticulum Ca2+ pump mRNA levels in cultured aortic smooth muscle cells from spontaneously hypertensive rats

We have observed previously that Ca2+ pump-mediated Ca2+ efflux is elevated in cultured aortic smooth muscle cells from spontaneously hypertensive rats compared to those from Wistar-Kyoto rat controls. The objective of this work was to determine if these strains differ in mRNA levels for the PMCA1 isoform of the plasma membrane Ca2+-ATPase and the SERCA2 isoform of the sarcoplasmic reticulum Ca2+-ATPase. mRNA levels were compared in cultured aortic smooth muscle cells from 10-week-old male rats. PMCA1 and SERCA2 mRNA levels were elevated in SHR compared to WKY. Angiotensin II increased the level of PMCA1 and SERCA2 mRNA in both strains. These studies provide further evidence for alterered Ca2+ homeostasis in hypertension at the level of Ca2+ transporting ATPases in the spontaneously hypertensive rat model. These data are also consistent with the hypothesis that the expression of these two Ca2+ pumps may be linked. (C) 1997 Academic Press

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Intracellular free Ca2+ and basal Mn2+ influx in cultured aortic smooth muscle cells from spontaneously hypertensive and normotensive Wistar-Kyoto rats.

Numerous studies investigating the possible role of altered Ca2+ homeostasis in hypertension have compared resting and agonist-stimulated intracellular free Ca2+ ([Ca2+](i)) in cultured aortic smooth muscle cells from spontaneously hypertensive (SHR) and normotensive Wistar-Kyoto (WKY) rats. However, such studies have not given consistent results. Differences in the method used to load cells with the Ca2+-sensitive indicator fura-2 have been investigated here as a possible source of variability between studies. We also describe the adaptation of a fluorescence technique for the assessment of basal Ca2+ permeability in SHR and WKY through the measurement of Mn2+ influx. The results are consistent with the hypothesis that basal Ca2+ influx is elevated in cultured aortic smooth muscle cells from SHR compared to those from WKY. However, this was not reflected as a significant difference between the two strains in basal or angiotensin II (200 nmol/L)stimulated [Ca2+](i). Furthermore, this result was not dependent on the protocol used to load cells with fura-2. Hence, measurement of bulk [Ca2+](i) does not appear to be the most sensitive parameter for altered Ca2+ homeostasis in SHR. Other compartments of the cell may better reflect altered Ca2+ fluxes in hypertension and are discussed in this work.

Molecular motion in miscible polymer blends .1. Motion in blends of PEO and PVPh studied by solid-state C-13 T-1 rho measurements

Changes in molecular motion in blends of PEO-PVPh have been studied using measurements of C-13 T-1 rho relaxation times. C-13 T-1 rho relaxation has been confirmed as arising from spin-lattice interactions by observation of the variation in T-1 rho with rf field strength and temperature. In the pure homopolymers a minimum in T-1 rho is observed at ca. 50 K above the glass transition temperatures detected by DSC. After blending, the temperature of the minimum in T-1 rho for PEO increased, while that for PVPh decreased, however, the minima, which correspond to the temperatures where the average correlation times for reorientation are close to 3.1 mu s, are separated by 45 K (in a 45% PEO-PVPh blend). These phenomena are explained in terms of the local nature of T-1 rho measurements. The motions of the individual homopolymer chains are only partially coupled in the blend. A short T-1 rho has been observed for protonated aromatic carbons, and assigned to phenyl rings undergoing large-angle oscillatory motion, The effects of blending, and temperature, on the proportion of rings undergoing oscillatory motion are analyzed.

Laboratory wear testing of polyurethane elastomers

A dry sand-rubber wheel abrasion test was used to investigate the wear behaviour of polyurethanes. The dry sand-rubber wheel abrasion test (DSRW test) is an approved ASTM test designed primarily for testing metals, therefore, in this study the set of test conditions was optimized for use with polyurethane elastomers. The wear performance of polyurethanes was assessed for the range of Shore hardness 85A to 65D, and a correlation was identified between the wear rate and the sample hardness. Polyurethane elastomers can be separated into three classes according to their hardness and wear performance, and each class shows a different dependence on the specimen temperature. This work has implications for use of the DSRW test for the prediction of field performance of polyurethanes. (C) Elsevier Science S.A.

2m-cycle systems of K2m+1/C-m

For all m greater than or equal to 3 the edges of complete graph on 2m + 1 vertices can he partitioned into m 2m-cycles and an m-cycle.

The chemistry of novolac resins .3. C-13 and N-15 nmr studies of curing with hexamethylenetetramine

The reactions between novolac resins and hexamethylenetetramine (HMTA) which occur on curing have been studied by C-13 and N-15 high-resolution n.m.r. in both solution and the solid state. Strong evidence for the existence of many curing intermediates is obtained. New curing intermediates are reported along with experimental data to support previously postulated intermediates. The initial curing reactions between novolac and HMTA produce various substituted benzoxazines and benzylamines. Thermal decomposition/oxidation and further reactions of these initial intermediates generate methylene linkages between phenolic rings for chain extension and cross-linking. Among the three kinds of methylene linkages, the para-para methylene linkages are formed at relatively lower temperatures. Various imine, amide and imide side-products also concurrently appear during the process. The initial amount of HMTA plays a critical role in the curing reactivity and chemical structures of the cured resins. The lower the amount of HMTA, the lower the temperature at which curing occurs, and the lower the amount of the nitrogen-containing side-products in the finally cured resins. The ortho-linked intermediates are relatively stable, and can remain in the cured resins up to higher temperatures. The study provides an extensive description of the curing reactions of novolac resins. (C) 1997 Elsevier Science Ltd.