Individual differences in motivated social cognition: The case of self-serving information processing

Three experiments examined the hypothesis that people show consistency in motivated social cognitive processing across self-serving domains. Consistent with this hypothesis, Experiment 1 revealed that people who rated a task at which they succeeded as more important than a task at which they failed also cheated on a series of math problems, but only when they could rationalize their cheating as unintentional. Experiment 2 replicated this finding and demonstrated that a self-report measure of self-deception did not predict this rationalized cheating. Experiment 3 replicated Experiments 1 and 2 and ruled out several alternative explanations. These experiments suggest that people who show motivated processing in ego-protective domains also show motivated processing in extrinsic domains. These experiments also introduce a new measurement procedure for differentiating between intentional versus rationalized cheating.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Risk factors for post-stroke depression

Objective. To examine possible risk factors in post-stroke depression (PSD) other than site of lesion in the brain Data sources. 191 first-ever stroke patients were examined physically shortly after their stroke and examined psychiatrically and physically 4 months post-stroke. Setting. A geographically defined segment of the metropolitan area of Perth, Western Australia, from which all strokes over a course of 18 months were examined (the Perth Community Stroke Study). Measures. Psychiatric Assessment Schedule, Mini Mental State Examination, Barthel Index, Frenchay Activities Index, physical illness and sociodemographic data were collected. Post-stroke depression (PSD) included both major depression and minor depression (dysthymia without the 2-year time stipulation) according to DSM-III (American Psychiatric Association) criteria. Patients depressed at the time of the stroke were excluded. Patients. 191 first-ever stroke patients, 111M, 80F, 28% had PSD, 17% major and 11% minor depression. Results. Significant associations with PSD at 4 months were major functional impairment, living in a nursing home, being divorced and having a high pre-stroke alcohol intake (M only). There was no significant association with age, sex, social class, cognitive impairment or pre-stroke physical illness. Conclusion. Results favoured the hypothesis that depression in an unselected group of stroke patients is no more common, and of no more specific aetiology, than it is among elderly patients with other physical illness.

Social rules and attributions in the personnel selection interview

The study investigated the social rules applicable to selection interviews, and the attributions ions made by interviewers in response to rule-breaking behaviours by candidates. Sixty personnel specialists (31 males and 29 females) participated in the main study which examined their perceptions of social rules and attributions about rule breaking in their work experience. They listened to audiotapes of actual selection interviews, and made judgments about hireability communication competence, and specific social rules. Results indicated that interview rules could be categorized into two groups: specific interview presentation skills and general interpersonal competence. While situational attributions were more salient in explaining the breaking of general interpersonal competence rules, internal attributions (ability, effort) were more salient explanations for the breaking of more specific interview rules (with the exception of the preparation rule where lack of effort was the most likely explanation for rule breaking). Candidates previously judged as competent communicators were rated more favourably on both global and specific measures of rule-following competence, as well as on hireability. The theoretical and practical implications of combining social rules and attribution theory in the study of selection interviews are discussed.

The uncharged surface features surrounding the active site of Escherichia coli DsbA are conserved and are implicated in peptide binding

DsbA is a protein-folding catalyst from the periplasm of Escherichia coli that interacts with newly translocated polypeptide substrate and catalyzes the formation of disulfide bonds in these secreted proteins. The precise nature of the interaction between DsbA and unfolded substrate is not known. Here, we give a detailed analysis of the DsbA crystal structure, now refined to 1.7 Angstrom, and present a proposal for its interaction with peptide. The crystal structure of DsbA implies flexibility between the thioredoxin and helical domains that may be an important feature for the disulfide transfer reaction. A hinge point for domain motion is identified-the typo IV beta-turn Phe 63-Met 64-Gly 65-Gly 66, which connects the two domains. Three unique features on the active site surface of the DsbA molecule-a groove, hydrophobic pocket, and hydrophobic patch-form an extensive uncharged surface surrounding the active-sits disulfide. Residues that contribute to these surface features are shown to be generally conserved in eight DsbA homologues. Furthermore, the residues immediately surrounding the active-site disulfide are uncharged in all nine DsbA proteins. A model for DsbA-peptide interaction has been derived from the structure of a human thioredoxin:peptide complex. This shows that peptide could interact with DsbA in a manner similar to that with thioredoxin. The active-site disulfide and all three surrounding uncharged surface features of DsbA could, in principle, participate in the binding or stabilization of peptide.

Computer technology - A political player in social policy processes

The absence of considerations of technology in policy studies reinforces the popular notion that technology is a neutral tool, Through an analysis of the role played by computers in the policy processes of Australia's Department of Social Security, this paper argues that computers are political players in policy processes, Findings indicate that computers make aspects of the social domain knowable and therefore governable, The use of computers makes previously infeasible policies possible, Computers also operate as bureaucrats and as agents of client surveillance. Increased policy change, reduced discretion and increasingly targeted and complex policies can be attributed to the use of computer technology, If policy processes are to be adequately understood and analysed, then the role of technology in those processes must be considered.

Competing notions of social justice and contradictions in special education reform

In the past three decades, special education has been subjected to extensive critique and reform of practices. These critiques have been based on notions of social justice and equity. However, the field has suffered from inadequate attention to assumptions about social justice. Social justice is essentially a contested concept. Rather than representing a unitary and universally shared concept, social justice has variable meanings. Differing views of social justice can be seen to underlie apparent contradictions in continuing practice in response to pressures for reform. Reforms predicated on individual rights have been undermined by deep commitments to meritocratic practices in U.S. schools. Reforms based on more communitarian principles, however, ignore the need for structure and the tendency for communal values to marginalize people with disabilities. Special education reform today requires a different basis in a relational definition of the self, structures to support the qualities of relationships, and a belief in the mutability of social justice.

Social adaptation of children with mild intellectual disability: Effects of partial integration within primary school classes

is study examined the social adaptation of children with mild intellectual disability who were either (a) partially integrated into regular primary school classes, or (b) full-time in separate classes, All of the children were integrated in sport and play activities with the whole school. Consistent with previous research, children with intellectual disability were less socially accepted than were a matched group of control children. Children in partially integrated classes received more play nominations than those in separate classes, brit there was no greater acceptance as a best friend. On teachers' reports, disabled children had higher levels of inappropriate social behaviours, but there was no significant difference in appropriate behaviours. Self-assessments by integrated children were more negative than those by children in separate classes, and their peer-relationship satisfaction was lower. Ratings by disabled children of their satisfaction with peer relationships were associated with ratings of appropriate social skills by themselves and their teachers, and with self-ratings of negative behaviour. The study confirmed that partial integration can have negative consequences for children with an intellectual disability.

The structure of versutoxin (delta-atracotoxin-Hv1) provides insights into the binding of site 3 neurotoxins to the voltage-gated sodium channel

Background: Versutoxin (delta-ACTX-Hv1) is the major component of the venom of the Australian Blue Mountains funnel web spider, Hadronyche versuta. delta-ACTX-Hv1 produces potentially fatal neurotoxic symptoms in primates by slowing the inactivation of voltage-gated sodium channels; delta-ACTX-Hv1 is therefore a useful tool for studying sodium channel function. We have determined the three-dimensional structure of delta ACTX-Hv1 as the first step towards understanding the molecular basis of its interaction with these channels. Results: The solution structure of delta-ACTX-Hv1, determined using NMR spectroscopy, comprises a core beta region containing a triple-stranded antiparallel beta sheet, a thumb-like extension protruding from the beta region and a C-terminal 3(10) helix that is appended to the beta domain by virtue of a disulphide bond. The beta region contains a cystine knot motif similar to that seen in other neurotoxic polypeptides. The structure shows homology with mu-agatoxin-l, a spider toxin that also modifies the inactivation kinetics of vertebrate voltage-gated sodium channels. More surprisingly, delta-ACTX-Hv1 shows both sequence and structural homology with gurmarin, a plant polypeptide. This similarity leads us to suggest that the sweet-taste suppression elicited by gurmarin may result from an interaction with one of the downstream ion channels involved in sweet-taste transduction. Conclusions: delta-ACTX-Hv1 shows no structural homology with either sea anemone or alpha-scorpion toxins, both of which also modify the inactivation kinetics of voltage-gated sodium channels by interacting with channel recognition site 3. However, we have shown that delta-ACTX-Hv1 contains charged residues that are topologically related to those implicated in the binding of sea anemone and alpha-scorpion toxins to mammalian voltage-gated sodium channels, suggesting similarities in their mode of interaction with these channels.